1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
trasher [3.6K]
3 years ago
5

Hi quiz they are screenshots if you dont know all five questions pls dont answer i need serious help 30 points

Chemistry
2 answers:
Pachacha [2.7K]3 years ago
7 0
#2 - D
it's goes cells, tissues, organs, organs systems
MatroZZZ [7]3 years ago
3 0

the first one is  the first option

You might be interested in
The volume of gas occupied 240.0ml when the pressure is 1.20 atm what volume at constant pressure.will the gas occupies when the
Marizza181 [45]

Answer:

334.89 ml

Explanation:

V2 = V1P1/P2

V2 = 240×1.2/0.86

V2 = 334.89 ml

7 0
3 years ago
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
3 years ago
What is the amount of solute per given amount of solvent?
DanielleElmas [232]

Answer:

Concentration

Explanation:

Concentration is measure of the quantity of solute present in a given amount of solvent. Concentration can be measured in mol/dm³, g/m³ and other forms like molality, parts per million.

Concentration in mol/dm³(molarity) is a measure of the amount of moles of solute present in 1 dm³ of solvent while concentration in g/dm³ is the number of grams of solute present in 1 dm³ of solvent. These units of concentration can be converted to the other unit by using simple conversion methods.

molality refers to the amount of solute in 1 kg of solvent, while ppm is basically used for very dilute solutions.

3 0
4 years ago
What's mass and volume when it comes from properties of matter?
Naddik [55]

Answer: Mass is the amount of matter in a substance. Volume is the amount of space matter takes up. Matter has both physical and chemical properties.

Explanation:Y w

5 0
3 years ago
A compound is formed when 12.2 g Mg combines completely with 5.16 g N. What is the percent composition of this compound? Please
Debora [2.8K]
3Mg + N₂= Mg₃N₂
n(Mg)=12,2g÷24,4g/mol=0,5mol-limiting reagentn
(N₂)=5,16g÷28g/mol=0,18mol
n(Mg₃N₂):n(Mg)=1:3, n(Mg₃N₂)=0,166mol, m(Mg₃N₂)=0,166·101,2=16,8g.
%(N)= 2·Ar(N)÷Mr(Mg₃N₂) = 2·14÷101,2=27,66%=0,2766
%(Mg) = 3·Ar(Mg)÷Mr(Mg₃N₂)= 3·24,4÷101,2=72,34% or 100% - 27,66%= 72,34%.
8 0
3 years ago
Other questions:
  • An unknown substance in aqueous solution is treated with various reagents including hexane, a colorless liquid less dense than w
    6·1 answer
  • What happens when a solid is dissolved into a liquid
    12·2 answers
  • Which methods would be suitable for determining the concentration of an aqueous solution of KMnO4? I. Visible spectrophotometry
    9·1 answer
  • Abigail obtained 18.9 grams of calcium carbonate after performing a reaction. From her calculations, she knew she should have ob
    14·1 answer
  • Is this right ? I’m stuck on the Explanation part .
    13·1 answer
  • Which of these pairs indicates an incorrect coupling of reversible reactions?dehydration synthesis and hydrolysisanabolic and ca
    10·1 answer
  • When 20 calories of heat is added to 2.0 grams of water at 15 c, the temperature of the water increases to?
    14·1 answer
  • Muiltplying 2.5 x 10^10 by 3.5 x 10^-7
    6·1 answer
  • 18. The lighter, outer part of the shadow is called til 9. The color of the moon during a lunar eclipse depends on the amount of
    6·2 answers
  • How many molecules of CH4 are in 24.1 g of this compound?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!