1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
S_A_V [24]
3 years ago
7

(0, 1) and (5,3) linear equation.

Biology
1 answer:
d1i1m1o1n [39]3 years ago
7 0

Answer:

y = 2/5x + 1

Explanation:

Slope-Intercept Form: y = mx + b

Slope Formula: m=\frac{y_2-y_1}{x_2-x_1}

Step 1: Find slope <em>m</em>

<em />m=\frac{3-1}{5-0}<em />

<em />m=\frac{2}{5}<em />

y = 2/5x + b

Step 2: Find y-intercept <em>b</em>

Given point (0, 1) as y-int.

y = 2/5x + 1

You might be interested in
If 1000 f2 offspring are obtained, how many flies of each phenotype are expected?
aniked [119]
<span>In Drosophila + indicates wild-type allele for any gene, m is mahogany and e is ebony. Female parents are m+/m+ and males are +e/+e. F1 are m+/+e, all wild type. F1 females are crossed with me/me males - the test cross. Offspring will be : non recombinant m+/me, mahogany wild type or +e/me wild type ebony. OR recombinant me/me mahogany ebony or ++/++ wild type. As the two genes are 25 map units apart, the percentage of recombinants will be 25% and therefore percentage parental types will be 75%. 75% 1000 is 750. There are two parental types, so you would expect 375 of each. Therefore, you would expect 375 m+/me and 375 +e/me. 25% of 1000 is 250 split between two recombinants =125 of each. Therefore you would expect 135 me/me and 125 ++/++</span>
7 0
3 years ago
How does using killed or weakened bacteria in an immunization help the body prevent infections
snow_lady [41]
<span>Basically, the body needs to know what it is defending against. Your body can still (usually) fight off infection, even without an immunization, but it takes longer. Basically, your body creates cells with a receptor for a specific disease. When this cell finds the disease it is programmed for, it will send out signals to the "killer" cells to come and kill it. If your body doesn't have the "seeker" cells, it can't fight off the infection until it does. The opposite end are autoimmune diseases, where your immune system starts attacking itself.

brainlest answer</span>
3 0
4 years ago
Read 2 more answers
How do you think it is possible to create over 100 000 different proteins from just 20 amino acids?
never [62]
<span>Protein is made up of building blocks called amino acids</span>
3 0
3 years ago
What protein (purine)-rich food should be limited to prevent a reoccurrence of uric acid kidney stones? what protein (purine)-ri
Nataliya [291]

Answer:

Eggs

Explanation:

Uric acid stones are one of the four types of kidney stones which are formed due to the high amount of uric acid in the human body.

When the concentration of the uric acid increases in the urine due to which urine becomes acidic, the uric acid gets stored in the urinary pathway in the form of stones.

To remove the uric acid kidney-stones, the food rich in purines must be avoided like meat, eggs and green vegetables like mustard, spinach, and whole grains are suggested.

Thus, the egg is the correct answer.

5 0
3 years ago
What's the leading cause of air pollution?
SpyIntel [72]

Burning fossil fuels

7 0
3 years ago
Read 2 more answers
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Starch is a _____.<br><br> monosaccharide<br> disaccharide<br> hormone<br> polysaccharide
    15·2 answers
  • Which of these is not a response of internal stimuli?
    14·2 answers
  • There is a pandemic of a contagious disease in the untied, states, there is only enough of th vaccine to cover 70% of the popula
    11·1 answer
  • What must an organism do to be considered successful according to natural selection?
    9·1 answer
  • Insects obtain oxygen through __________________________, which are small abdominal holes that lead into tracheal tubes called t
    12·1 answer
  • A common column material used in size-exclusion chromatography is dextran, a polysaccharide of glucose. Which type of interactio
    10·1 answer
  • PLEASE ANSWER/ NO JOKE PLEASE DONT USE THIS FOR POINTS
    8·1 answer
  • Please help me asap
    15·2 answers
  • What changes when a cell divides into two daugther cells to make it easier for the cells to exchange materials across the surfac
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!