Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
Here the fucose is linked to galactose by alpha1,2 glycosidic linkage.
Explanation:
Fucose is a deoxy sugar consist of 6 carbon atoms which means fucose is a hexose sugar.
Fucose does not contain -OH group at C6 carbon that"s why it is termed as deoxy sugar.
Fucose can link to both Nactylglucosame by alpha-1,6 glycosidic linkage and to galactose by alpha-1, glycosidic linkage generates the H antigen.
As donor is blood type B that means fucose is linked to galactoseof H antigen by alpha 1,2glycisidic linkage.
Answer:
Humans have destroyed and modified various locations, such as forests, jungles, oceans. They begin to modify an environment in order to build new infrastructures, like buildings, factories, or even communities.
Explanation:
The reason for this is because they want to get as much resources for economic purposes, like for example mines, touristic places, factories. At first, this interaction affects the environment more, because of the loss of species or resources due to the human activity. Then, after this, it will affect the human, because of the lack of resources and global contamination caused by the environment being destroyed or modified.
