C) carbon dioxide and water is the answer
Resistance stage of the general
adaptation syndrome (gas)
Resistance stage is the second
stage in which the body goes through series of changes while trying to resist
or adapt to the stressor. For the question given above, according to Hans Selye,
Katie is currently in the resistance stage of the general adaptation syndrome
(gas).
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
The resistance of the bacteria to antibiotics is increasing and the disease which were easily treatable using the antibiotics, are now incurable and bacteria becomes resistant.
The overdose and misuse of antibiotics Is a big concern of worry. Every time we use antibiotics, it will kill the bacteria which were sensitive but resistant bacteria will survive and starts growing and this process will increase the growth of the resistant bacteria upon the nest use of the antibiotics.
Also due to unawareness, the use of antibacterial tablets against viral infections also cause increase in resistance of bacteria against antibiotics.
Hello. It is not possible to access the website you are referring to, but I will try to help you in the best possible way.
Natural selection is the term created by Chales Darwin to compose a theory of biological evolution. According to this term, living beings that have characteristics favorable to their survival, in relation to the environment in which they live, are more likely to survive and pass these characteristics on to their descendants, while those that do not have these characteristics are more likely to die. .
An example of this can be seen in a population of lizards that live in environments with a lot of grass. According to natural selection, green colored lizards would have better advantages of surviving because they would be camouflaged in the grass and would not be seen by predators, unlike red lizards, which would be easily identified and captured by predators. therefore, the population of red lizards would decrease until it ceased to exist, while the population and green lizards would survive and generate other green lizards.
