1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
patriot [66]
3 years ago
14

Gene therapy is an integral part of genome projects. It includes the correction of abnormal genes responsible for diseases. Whic

h of these is an application of gene therapy?
A)
The removal of cells with abnormal genes from the body by surgical methods.
B)
Designing drugs to inhibit the function of a protein coded by an abnormal gene.
C)
The introduction of a new gene that can bind with the abnormal gene to inhibit its action.
D)
The inhibition of all the genes associated with the abnormal gene to regulate their actions.
Biology
2 answers:
lbvjy [14]3 years ago
6 0
I think option c is right that is <span>The introduction of a new gene that can bind with the abnormal gene to inhibit its action.
Hope it helps .</span>
mezya [45]3 years ago
4 0

Answer:

correct answer is c

Explanation:

You might be interested in
Marking PEOPLE AS BRAINLIST <br><br> what is the purpose of mitosis
Maurinko [17]

Answer:

the purpose of mitosis is that the new cell can divide in to two new cells

Explanation:

6 0
3 years ago
What is an example of chemical weathering, as opposed to mechanical weathering?
Ratling [72]
 the answer is oxidation :)
5 0
3 years ago
Read 2 more answers
What do scientists believe may have happened to leave Mars vulnerable to the solar winds?
ratelena [41]
The outer core of Mars cooled too quickly and the magnetic field didn't have time to fully form so the solar winds destroyed the magnetic field and the atmosphere
8 0
4 years ago
How is framing contributing to the decline in biodiversity
marin [14]
All forms of farming have major impacts on biodiversity, especially when new land is brought into cultivation. Habitats are destroyed and new ecological niches created which allow typical farmland species of birds, insects, mammals and weeds to establish themselves.
6 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • What is the name of the tear drainage channel that extends from the lacrimal sac to the opening in the mucous membrane of the no
    8·1 answer
  • ___ are made through human senses, instruments, or measuring devices?
    11·1 answer
  • Write an example of an element using its name and symbol
    15·1 answer
  • What are 3 things you can determine about different types of paper
    10·1 answer
  • A form of dementia that causes progressive changes in brain cells is ____
    11·1 answer
  • Which gas has a greater potential to harm the atmosphere: methane or carbon dioxide? Use data from the table to explain your ans
    12·2 answers
  • Why is short-term environmental change more likely to negatively affect a population than a long-term change?
    15·1 answer
  • How does the body's immune response operate to fight infection?
    10·2 answers
  • Usain bolt was on his way to run a race. Before he left the house, his friend gave him annapple and said this will help you win
    11·1 answer
  • HELP ME
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!