1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AlexFokin [52]
4 years ago
9

Best define gene flow?

Biology
1 answer:
Maslowich4 years ago
7 0
Gene flow — also called migration — is any movement of individuals, and/or the genetic material they carry, from one population to another. Gene flow includes lots of different kinds of events, such as pollen being blown to a new destination or people moving to new cities or countries.
You might be interested in
Why are fossil fuels considered nonrenewable resources if they are still forming?
Leni [432]

Answer:

a

Explanation:

Fossil fuels are considered non renewable because they take millions of years to form but depleted faster than they are formed.

6 0
3 years ago
Fluid ____________ exists when fluid ____________ (the addition of water to the body) is equal to fluid ____________ (the loss o
kupik [55]
The two major fluid is intracellular and extracellular
6 0
3 years ago
A model of pluripotent vs differentiated cellular gene expression is shown. Pluipotency is found in stem cells that have the abi
Svetlanka [38]

Answer:

The correct answer is D

Explanation:

3 0
3 years ago
Read 2 more answers
What is the importance of the cell cycle?
Mama L [17]
The cell cycle is the most important process in the growth of the organisms, so its control is very complicated, since even a small mistake can have a huge importance for the cell. ... Everytime any cell reaches the S phase, there is no more limitation for it and DNA replication and mitosis always take place.
5 0
3 years ago
From deep to superficial, the order of the strata of the epidermis is
pashok25 [27]
Name the five layers of epidermis. Which layer is found only in thick skin? Superficial to deep: Stratum corneum, stratum lucidum, stratum granulosum, stratum spinosum, stratum basale
7 0
3 years ago
Other questions:
  • Plants do not just use photosynthesis to make sugars for
    14·1 answer
  • The nurse is considering risk factors for influenza in a group of preschool children. which factors are considered to place chil
    14·1 answer
  • can anyone please help on my biology hw) Directions: A group of scientists recently found members of a plant species they did no
    6·1 answer
  • Proteins are polymers composed of long chains of
    7·1 answer
  • Of earths total volume of fresh Walter what percentage is frozen
    14·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Which two atoms form an ionic bond?
    9·2 answers
  • The brief electrical impulse by which information is transmitted along the axon of a neuron is called a(n): refractory period. s
    13·1 answer
  • How we save water during washing clothes
    11·1 answer
  • Provide brief overview of the nervous system and its role in the maintenance of homeostasis.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!