3 years ago

3. Name the six kingdoms of life, and give two charac-teristics of each.

Biology

1 answer:

IRISSAK [1]3 years ago

3 0

Answer:

Animalia - multicellular, eukaryotic

Plantae - vacuolate eukaryotic cells, multicellular

Protista - unicellular and multicellular, eukaryotic

Fungi - decomposers, non-motile

Eubacteria - unicellular, prokaryotic

Archaebacteria - no peptidoglycan, glycoproteins and polysaccharides in cell walls.

Hope that helps. :)

You might be interested in

A possible explanation for glacial retreat other than global warming is

vampirchik [111]

Other than global warming is Desalinezation.

5 0

3 years ago

The blood pressure in blood vessels decreases with the distance the blood travels, starting from when it was pumped out of the h

Alecsey [184]

Capillaries to veins to arteries

7 0

3 years ago

Which of these statements best describes prey

Harrizon [31]

Prey Definition:

Any animal that is killed and eaten by another animal.

6 0

2 years ago

Which of these statements is true of the hypothalamus? a) It controls emotional responses and provides information on equilibriu

trasher [3.6K]

Answer: B) It controls the autonomic nervous system and regulates hunger and thirst sensations.

8 0

4 years ago

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0

3 years ago

3. Name the six kingdoms of life, and give two charac-teristics of each.​

3. Name the six kingdoms of life, and give two charac-teristics of each.