1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Verdich [7]
3 years ago
6

How is the worlds food produced

Biology
1 answer:
Semenov [28]3 years ago
8 0

Answer:

About 40% is from crop farming and the remaining 60% from livestock, including wool, meat and dairy farming.

Explanation:

You might be interested in
Which of the following statements is false? The hormone progesterone causes the endometrium to become thicker. After the ovarian
bazaltina [42]

Answer:

A woman creates new immature ova in the ovary each time she has a menstrual cycle.

Explanation:

During the menstrual cycle, hormones present in the body make the immature eggs 'mature' ones, in the ovary. About in half of the cycle, hormones make the release of the mature egg from the ovary and travels towards uterus. It can remain there for 24 hours and if not fertilized the it breaks down and released out.

3 0
3 years ago
Read 2 more answers
What does GMO stand for. Explain what it is in your own words.
Sholpan [36]
GMO stands for “genetically modified organism”, which is a new organism, not found in nature, created by scientists when they genetically modify or engineer food plants.
3 0
3 years ago
Read 2 more answers
Which clinical theorist identified the three essential features of all forms of therapy?
Anettt [7]
The scientific study of abnormal behavior in an effort to describe, predict, explain, and change abnormal patterns of functioning
6 0
3 years ago
I NEED HELP NOWWWW! This site is a beachfront property on the east coast of the United States known to have a storm. Choose all
larisa86 [58]

Answer: flooding, high winds, Avalanches, earthquakes

Explanation:

Your picture

6 0
3 years ago
Explain how water makes its way to the leaves in the tops of the tallest trees against the force of gravity. Name what the climb
Novay_Z [31]

Answer:

Adhesion and cohesion are water properties that affect every water molecule on Earth and also the interaction of water molecules with molecules of other substances. Essentially, cohesion and adhesion are the "stickiness" that water molecules have for each other and for other substances. Credit: J. Schmidt, National Park Service

Explanation:

6 0
2 years ago
Read 2 more answers
Other questions:
  • Are all cattle breeds the same species?
    12·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • incomplete dominance is seen in snapdragon. The allele that causes red flowers (F) is not completely dominant over the allele th
    12·2 answers
  • How does the mass of Venus compare to the mass of the Earth?<br>(Give Me A Paragraph)
    15·1 answer
  • WILL GIVE A BRAINLEST AND I ALSO THINK THE ANWERS IS A BUT IM NOT SURE
    9·1 answer
  • why does my cat act rough with her kittens ? WHO GIVES A REASONABLE ANSWER GET'S BRAINLIEST.(This is not from a subject just cur
    8·2 answers
  • Which type of microorganism causes gonorrhoea
    8·1 answer
  • List the cell organelles involved in energy generation for the cell.
    10·1 answer
  • Which two naturalists were responsible for the development of The Principle of Natural Selection?
    5·1 answer
  • In an energy pyramid, the bottom level represents...
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!