Answer:
Occasionally, an X-ray is done to determine the size of the adenoids. Like tonsils, adenoids help to defend the body from infection. They trap bacteria and viruses which you breathe in through your nose. They contain cells and antibodies of the immune system to help prevent throat and lung infections.
<span>According to scientific evidence, earth’s earliest atmosphere lacked oxygen. Over time, oxygen was added to the atmosphere. Which statements explain how this change occurred and how it affected life on earth? Choose all answers that are correct. A. The addition of oxygen to the earth's atmosphere helped</span>
Answer:the fundamental explanation for the cause of cancer is that
Explanation:
It makes it easier to locate the specimen if you put it on low power!
Answer:
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
TTAAGCGGCCATAATCTGCAA
Explanation:
