1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alinara [238K]
3 years ago
15

You learned that members of this class were formerly divided into two groups: Errantia and Sedentaria.

Biology
1 answer:
Nataly [62]3 years ago
5 0
<h2>Polychaetes </h2>

Explanation:

  • Polychaetes is any of the diverse, mostly marine segmented worms of the annelid class Polychaeta, characterized by having most segments with one pair of lateral, fleshy, lobe like appendages called parapodia, with numerous bristles projecting from them
  • Polychaetes have true segments and anterior to the true segments lie the prostomium and peristomium
  • This head region of two segments typically contains two pairs of eyes, three antennae, several tentacles, a pair of palps, and the mouth
  • Polychaeta is divided into Errantia and Sedentaria for convenience
  • Errantia (scaleworms, sea mice):A subclass of polychaete worms which have a large number of body segments, those of the head and posterior differing from the rest,the mouth often has several paired jaws
  • Most are vagile predators, others adopt a burrowing mode of life and are first recorded from the Cambrian
  • Sedentaria (bamboo worms, coneworms):A subclass of entirely marine worms in which the body segments and parapodia differ along the length of an individual,all Sedentaria are burrowers or tube-dwellers and are first recorded from the Ordovician

You might be interested in
If a cell were treated with poison to block to function of its michocondria which of the following would be likely result?
blagie [28]
<span>The pH of the matrix increases and the pH of the inter membrane cell decreases
</span>
The reason behind this is the presence of the electron transport chain within the mitochondria which requires the transport of hydrogen ions. The movement of hydrogen ions results in varying pH. If the mitochondria dies, the hydrogen ions will not move into the matrix, causing its pH to increase, and they will build up in the inter membrane causing a decrease in pH.
6 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Which structures shown in the Figure make up the ADP molecule?
Y_Kistochka [10]
Answer: A,B and C

Explanation
6 0
3 years ago
Question 5 of 10
Ratling [72]

Answer:

A

Explanation:

geothermal energy, solar energy, and wind energy increased, and in 2019, the combined percentage share of these renewable energy sources was greater than the combined share of wood and hydro energy.Jun 22, 2020

5 0
3 years ago
The theory of plate tectonics:
sertanlavr [38]

A) .was immediately accepted

Explanation:

The theory of plate tectonics was immediately recognized as the explanation for the moving continents. It provided a more scientific background as why continents drift apart and the seafloor keeps spreading.

  • The theory explains that the earth is broken up into series of slabs called lithosphere which moves on the weak, ductile and fluid asthenosphere.
  • The movement of part of the earth mantle provided the mechanism through which the lithosphere moves. This is now known as the mantle convection.
  • This theory provided a scientific mechanism through which the plate moves and seafloor spreads.
  • It was immediately accepted when the theory was propounded by Alfred Holmes in the 1930s

Learn more;

Continental drift brainly.com/question/5002949

#learnwithBrainly

6 0
2 years ago
Other questions:
  • Which microscope did Robert Hooke use to study tree bark?
    8·2 answers
  • The combination of dry, dusty soil and high winds produced an era known as the __________.
    14·1 answer
  • Mitochondria are unique organelles in several ways. They contain a specific genome that allows them to code for their own protei
    11·1 answer
  • What is a herbivore
    7·1 answer
  • intracytoplasmic iron ganuakes can be seen as anither distinct morphologic appearance of copper deficiency true or false​
    8·1 answer
  • How are water molecules arranged in a liquid?
    9·2 answers
  • PLEASE HELP !! ILL GIVE BRAINLIEST *EXTRA 40 POINTS* DONT SKIP :(( .!
    12·1 answer
  • What do immune cells do when they come in contact with a virus?
    6·2 answers
  • A certain atom has 26 protons, 26 electrons, and 30 neutrons. Its mass<br> number is
    15·2 answers
  • Need help with this
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!