1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anit [1.1K]
3 years ago
8

What do chicken pox, measles, polio and influenza all have in common?

Biology
1 answer:
Anton [14]3 years ago
6 0
B~ All caused by viruses
You might be interested in
Cross two pea plants. Both are heterozygous for seed type; round (R) is dominant to wrinkled (r).
Fudgin [204]

Answer: I hope the file helps you out :)

Download pdf
5 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
What are the two types of biological interactions?
Nimfa-mama [501]

Answer:

They can be either of the same species (intraspecific interactions), or of different species (interspecific interactions). These effects may be short-term, like pollination and predation, or long-term; both often strongly influence the evolution of the species involved. A long-term interaction is called a symbiosis.

7 0
4 years ago
Roger sperry conducted important research in what field of study?
icang [17]
Split-brain patients
6 0
3 years ago
20 PONITS! Need answers from 15-22
Serga [27]
Hii and says he will not have any other plans to because he’s going up to north and north west of west
7 0
3 years ago
Read 2 more answers
Other questions:
  • How can carbon move from land to bodies of water
    14·1 answer
  • Which would likely live near a crack in the deep ocean floor that spews scalding water? A. halophile B. methanogen C. thermoacid
    14·2 answers
  • Put the steps of the cardiac cycle into the correct order, starting with the beginning of the cardiac cycle. isovolumetric contr
    14·2 answers
  • Which of the following is not true concerning the zebra mussel in the united states?
    7·2 answers
  • This is the system of organs which circulate blood around the body of most animals.
    14·2 answers
  • Properties that change when the size of an object changes are called
    5·1 answer
  • Need answer now!! Please help
    15·1 answer
  • Some roses have streaks of pink and streaks of red to give a striped effect to
    7·1 answer
  • Identify the energy carrief molecule<br>(ATP) and it's importance?​
    8·1 answer
  • 4) Aos poucos, as pessoas estão aderindo às lâmpadas de LED que são mais eficientes, pois
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!