1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dezoksy [38]
3 years ago
7

Pick correct match No cell wall only plasma membrane

Biology
2 answers:
Karo-lina-s [1.5K]3 years ago
7 0

Answer:

Animal and plant cell

Explanation:

olga2289 [7]3 years ago
4 0
Animal cells. Plant cells have a cell wall.
You might be interested in
An object at rest will stay at rest and an object in motion will stay in motion at a constant speed and in the same direction, u
Sidana [21]
This would be Newton's first law of motion as it is a factual statement based on observations.
8 0
3 years ago
Read 2 more answers
During the process of_____,a molecule such as glucose must use a protein channel to cross through a cell membrane.
STatiana [176]
Facilitated diffusion.
5 0
3 years ago
Tissue grafts harvested from a different animal species are known as ________.
STALIN [3.7K]
Xenografts are tissue grafts harvested from a different animal species.
4 0
3 years ago
1. The amount of matter something has is _____.
tino4ka555 [31]

I believe the blank is "mass."

7 0
3 years ago
Read 2 more answers
What do you hear a sound when you crack your knuckles
Yuki888 [10]

Answer:

your joints, stretch the joint capsule. Gas is rapidly released, which forms bubbles.

Explanation:

7 0
2 years ago
Other questions:
  • To determine whether two organisms are related, scientists may compare the _____ of their cells.
    13·1 answer
  • Briefly explain the role of memory cells in adaptive immunity.​
    14·1 answer
  • Which of the following is the earliest step in transcription? A. RNA polymerase encounters a termination signal, and the DNA mol
    6·2 answers
  • Which of the following might trigger erythropoiesis?
    5·1 answer
  • Although the citric acid cycle itself does not use O₂, it requires a functioning electron transport chain (which uses O₂) in ord
    5·1 answer
  • . Label the parts of the sperm cell below
    6·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Many living things depend on
    7·1 answer
  • Ang____ ay pagbabago ng isa o higit pang mga pisikal na katangian ng bagay​
    13·1 answer
  • A genetic word is also known as a
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!