1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elis [28]
3 years ago
6

Which of the following is true of the relationship between DNA and enzymes such as DNA lipase?

Biology
1 answer:
Crazy boy [7]3 years ago
5 0
It would be D: Each substance plays a role in the formation of the other
You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
The dumping of garbage caused the population of crabs in an area to drop from 2,000 to 500. Crabs eat algae and are preyed on by
DIA [1.3K]
Algae will be overgrown and larger fish will begin to die out as the carrying capacity has lowered due to a limit in food.
8 0
3 years ago
Please help me please
mars1129 [50]

Answer:

There's not enough information to answer this. You need to provide the information on the people.

6 0
3 years ago
The outer ear consists of the _____.
Svet_ta [14]
The outer ear consists of two things and they are the auricle and the ear canal , which is also called the auditory canal.

The auditory canal  goes from the outer ear to the middle ear.

The auricle is what we see of the ear...the physical part of the ear. It can be called the pinna as well.


I hoped that this helped and good luck.
5 0
3 years ago
Read 2 more answers
Meat is not a good source of protein because it does not provide the body with all the essential amino acids.
tankabanditka [31]

Answer: False.

Meat is a good source of protein. There are nine essential amino acids which are required under special conditions like illness.

These are-  Histidine, Leucine, Isoleucine, Valine, Threonine, Methionine, Lysine, Phenylalanine and Tryptophan. They cannot be synthesized by the body and therefore need to be taken from external protein sources.

Since meat contains all the essential amino acids, therefore it is considered as a good source of protein. Hence, the given statement is false.

3 0
3 years ago
Read 2 more answers
Other questions:
  • Gh
    13·1 answer
  • ASAP test Monday
    5·1 answer
  • ________ of food can destroy cell membranes and attack dna and proteins, thus preventing microorganism growth.
    7·1 answer
  • HELPPPP!!!! Changes in ecosystems can be attributed to natural causes, such as natural disasters, seasonal variations
    15·1 answer
  • Fragments of volcanic rock and ash that build up to form cinder cones are known as
    8·1 answer
  • What is used to measure when the cardiovascular system is receiving the most benefit from exercise without working too hard?
    12·2 answers
  • Which of the following is an example of succession in an ocean ecosystem?
    8·2 answers
  • A ruler has markings as shown below. Stefan uses this ruler to measure the length of a metal rod.
    5·2 answers
  • 21 Which pair of substances is transported in the phloem?
    12·2 answers
  • Origina
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!