1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Setler79 [48]
3 years ago
9

Tellurium is a silvery-white, brittle element. Its electrical conductivity varies, but I’m creases slightly with exposure to sun

light. This element belongs to which region of the periodic table of the elements? A) metals B) metalloids C) nonmetals D)noble gases
Chemistry
2 answers:
Lina20 [59]3 years ago
5 0
B) Tellurium is a metalloid. Metalloids in some classifications are also or alternatively called “semi-metals.”
fgiga [73]3 years ago
3 0
It belongs to the metalloids
You might be interested in
A buffer solution contains 0.306 M C6H5NH3Br and 0.418 M C6H5NH2 (aniline). Determine the pH change when 0.124 mol HCl is added
Ulleksa [173]

<u>Answer:</u> The pH change of the buffer is 0.30

<u>Explanation:</u>

To calculate the pH of basic buffer, we use the equation given by Henderson Hasselbalch:

pOH=pK_b+\log(\frac{[\text{conjugate acid}]}{[\text{base}]})

pOH=pK_b+\log(\frac{[C_6H_5NH_3^+]}{[C_6H_5NH_2]})        .....(1)

We are given:

pK_b = negative logarithm of base dissociation constant of aniline  = 9.13

[C_6H_5NH_3^+]=0.306M

[C_6H_5NH_2]=0.418M

pOH = ?

Putting values in equation 1, we get:

pOH=9.13+\log(\frac{0.306}{0.418})\\\\pOH=8.99

To calculate pH of the solution, we use the equation:

pH+pOH=14\\pH_{initial}=14-8.99=5.01

To calculate the molarity, we use the equation:

\text{Molarity of the solution}=\frac{\text{Moles of solute}}{\text{Volume of solution (in L)}}

Moles hydrochloric acid solution = 0.124 mol

Volume of solution = 1 L

Putting values in above equation, we get:

\text{Molarity of HCl}=\frac{0.124}{1L}\\\\\text{Molarity of HCl}=0.124M

The chemical reaction for aniline and HCl follows the equation:

                   C_6H_5NH_2+HCl\rightarrow C_6H_5NH_3^++Cl^-

<u>Initial:</u>           0.418        0.124           0.306

<u>Final:</u>             0.294          -                0.430

Calculating the pOH by using using equation 1:

pK_b = negative logarithm of base dissociation constant of aniline  = 9.13

[C_6H_5NH_3^+]=0.430M

[C_6H_5NH_2]=0.294M

pOH = ?

Putting values in equation 1, we get:

pOH=9.13+\log(\frac{0.430}{0.294})\\\\pOH=9.29

To calculate pH of the solution, we use the equation:

pH+pOH=14\\pH_{final}=14-9.29=4.71

Calculating the pH change of the solution:

\Delta pH=pH_{initial}-pH_{final}\\\\\Delta pH=5.01-4.71=0.30

Hence, the pH change of the buffer is 0.30

8 0
3 years ago
If the neutral atom of an element has only 4 valence electrons it must be in which group? 1. IVB 2. VA 3. VIIA 4. VIA 5. IVA 6.
lisabon 2012 [21]

Answer:option

Option 5..IVA

Explanation:

5 0
3 years ago
Which compound contains both ionic and covalent
musickatia [10]

Answer:

(3) NaNO₃

Step-by-step explanation:

Sodium nitrate has ionic bonds, because it consists of Na⁺ and NO₃⁻ ions.

However, the nitrate ions have <em>covalent bonds</em> between the O atoms and the central N atoms.

(1) and (2) are <em>wrong</em>. Both N₂O₅ and HCl consist of nonmetals, so they are <em>covalent</em> compounds.

(4) is <em>wrong</em>. NaCl has <em>only ionic bonds</em> between the Na⁺ and Cl⁻ ions

7 0
3 years ago
Read 2 more answers
How does a chemist count the number of particles in a given number of moles of a substance?
jolli1 [7]
The chemist the count the number of particles (Atoms, Molecules or Formula Unit) in a given number of moles of a substance by using following relationship.

                              Moles  =  # of Particles / 6.022 × 10²³

Or,

                              # of Particles  =  Moles × 6.022 × 10²³

So, from above relation it is found that 1 mole of any substance contains exactly 6.022 × 10²³ particles. Greater the number of moles greater will be the number of particles.
8 0
3 years ago
Matter doesn't have to take up space as long as it has mass.
____ [38]

Answer:

Matter always takes space (or has volume).

7 0
3 years ago
Read 2 more answers
Other questions:
  • An industrial chemist is studying the rate of the haber synthesis: n2 + 3h2 → 2nh3. starting with a closed reactor containing 1.
    8·2 answers
  • Rusting of iron is an example of oxidation reduction or transmutation
    10·1 answer
  • How many kilojoules are associated with the formation of 2 moles of HBr(g)
    9·2 answers
  • Which metal atom below cannot form a cation of several different charges?
    13·1 answer
  • An action potential is regarded as an example of a positive feedback. Which of the following examples below best illustrates the
    11·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • What material would make the best heating element for an electric range?
    10·2 answers
  • Iron has a density of 7.86 g/cm3. Calculate the volume (in dL) of a piece of iron having a mass of 4.26 kg . Note that the densi
    15·1 answer
  • When pumping air into a tire, you have to pull back on the pump plunger to fill the pump with air. This increases the volume of
    5·2 answers
  • explain what happens if high pressure is implemented on the equilibrium reaction . State your observations for both rate of reac
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!