1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olganol [36]
3 years ago
11

The negative affect occer when there is a decrease in the air quality true ?

Biology
2 answers:
irina1246 [14]3 years ago
5 0

The correct answer would be true

artcher [175]3 years ago
3 0
The correct answer would be false
You might be interested in
What is a gene??????????????!!!!!!
sergejj [24]
A gene is a hereditary trait in your body and also apart of your DNA not visible to the naked eye making up how you look
3 0
3 years ago
Read 2 more answers
Why is it important to study people of color and their significance to scientific discovery?
alexandr402 [8]

Answer:

a depressive and monotonous atmosphere as well as a happy, exciting and stimulating one. Appropriate colors are important in terms of protecting eye health, providing a creative and productive space and protecting physical and mental health.

Explanation:

i hope this helps.

5 0
2 years ago
Enter your answer in the provided box. what is the value of ni for an electron that emits a photon of wavelength 95.04 nm when i
Sloan [31]
<span>Ni = 5 The Rydberg formula for hydrogen is 1/w = R(1/a^2 - 1/b^2) where w = wavelength in vacuum R = Rydberg constant 1.0973731568508x10^7 1/m a,b = integers greater than or equal to 1 and a < b Now we need to select the value for a. a = 1 will converge towards 91.13 nm a = 2 converges towards 364.51 nm a = 3 converges towards 820.14 nm ... Because of this, we will assume a = 1 for this problem since it converges closest to the wavelength given. Substitute known values 1/w = R(1/a^2 - 1/b^2) 1/9.504x10^-8 = 1.0973731568508x10^7(1/1^2 - 1/b^2) 10521885.52 = 1.0973731568508x10^7(1/1 - 1/b^2) 0.958824759 = 1 - 1/b^2 -0.041175241 = -1/b^2 0.041175241 = 1/b^2 24.28643927 = b^2 4.928127359 = b So Ni = 5.</span>
3 0
3 years ago
What element is found in all organic compounds? oxygen nitrogen carbon helium
harkovskaia [24]
The answer is carbon

7 0
3 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • Which statement best defines the relationship between marine biology and oceanography? Marine biology is the study of marine org
    12·2 answers
  • 1. An advantage of light microscopes compared to electron microscopes is that light microscopes . . A)allow you to view living c
    11·2 answers
  • What function do nucleic tides serve besides storing genetic information
    7·1 answer
  • The gene for alfa globlin and beta globlin are found
    7·2 answers
  • In what way is the nervous system comparable to electricity?
    14·1 answer
  • Water is water warmed by
    9·2 answers
  • Enzymes work by _____.
    15·2 answers
  • Where does water exit a starfish?
    13·1 answer
  • Plants make food through photosynthesis, a chemical reaction.
    12·2 answers
  • What is the law of conservation of energy?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!