1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dmitriy789 [7]
3 years ago
11

Gas exchange in an echinoderm takes place through

Biology
1 answer:
Hunter-Best [27]3 years ago
7 0
D. None of the above
You might be interested in
You water three sunflower plants with salt water. Each plant receives a different concentration of salt solutions. A fourth plan
Kruka [31]

Answer:

The fourth plant that receives pure water is the control group.

Explanation:

The election of a control group is essential in an experiment. Its principal purpose is to allow the discrimination of the results obtained by the treatment in the study, in this case, <em>the different concentrations of salty water that each plant receives</em>. The control group provides a reference point. It must be selected from the same population of the treatment groups. Both groups must be similar in every variable that might influence the results, <u>except for the study treatment.</u>

5 0
2 years ago
Help me ans this question please.
Umnica [9.8K]
It’s a study of unusual behaviors,emotion,and thought hope this helped
3 0
3 years ago
Help please!!!!!!!! Its integrated science ​
iVinArrow [24]

Answer:

True

Explanation:

6 0
3 years ago
Seventy to 90 percent of the genetic material in a gamete made in your body could be inherited from your mother. how could this
andre [41]
A mother passes on her mt(DNA) or mitochondrial DNA which sometimes includes genetic material but a father only passes down a Y chromosome if he has a son. No genetic material.
6 0
3 years ago
Where do scientist believe that homo sapiens sapiens first appeared between 150000 and 200000 years ago?
8_murik_8 [283]
Homo sapiens means wise human being, it one of several species grouped into the genus Homo, but it is the only one that is not extinct. It is the specie where all human beings belong. They replaced Neanderthals during 30,000 BC. Scientists believe that Homo sapiens appeared in Africa between 150,000 and 200,000 years ago.
5 0
3 years ago
Other questions:
  • A marine fish has about 1% salt in his body. The ocean water is 3.5%. Will water move into or out of the fish?
    5·2 answers
  • Most of the world's population lives in:
    6·2 answers
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Determine the correct sequence of events during the creation of recombinant DNA. I. Plasmid is cut open with enzymes II. Target
    15·1 answer
  • Could adaptation be acquired? Explain your answer.
    5·2 answers
  • : which surgical procedure involves incision of the thyroid gland
    5·2 answers
  • What happens during the initiation step of DNA transcription? A ribosome attaches to the initiation codon of a completed mRNA st
    10·1 answer
  • PLS HELP ASAPBacteria, viruses, protists, parasites, and fungi can all cause disease and can be referred to as ______.
    5·1 answer
  • The thin skin that appears to form on water’s surface occurs because of
    11·1 answer
  • What is biological abundance - BRAINLIEST IF RIGHT
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!