All categories

3 years ago

Which one of the following is the highest level of environmental organization?

1 answer:

7 0

Levels of organization<span> in ecology include the population, community, ecosystem, and biosphere. An ecosystem is all the living things in an area interacting with all of the abiotic parts of the </span>environment<span>.

k12 I know the struggle I did this test in middle school</span>

You might be interested in

___ have many angiosperm-like features

Crank

Ginkgos have many angiosperm-like features

7 0

3 years ago

Please help :)

Nataly [62]

Explanation:

1. F

2.T

3.T

4.F

5.F

6.T

7.T

3 0

2 years ago

Which one of the following statements is true of enzyme catalysts? A) Their catalytic activity is independent of pH. B) They are

muminat

Answer:

D) They can increase the reaction rate for a given reaction by a thousand-fold or more.

Explanation:

Enzymes are like catalysts with the only difference that they are bio-molecules. Biochemical/chemical reactions are slow because of 'transition state barriers' which require a lot of energy to overcome so enzymes rather than overcoming transition state barrier provide an alternate pathway for biochemical reactions which require comparatively less energy. Thus presence of an enzyme leads to an increase in reaction rate because alternate pathway which requires less energy makes the rate of chemical reaction rapid by a thousand-fold or more.

5 0

3 years ago

Identify the variable

galina1969 [7]

Answer: independent variable- strawberries that got water

dependent variable- water

control- strawberry that didn’t get any water

Explanation:

7 0

2 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago