1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Soloha48 [4]
3 years ago
5

Movement of the upper limb away from the trunk is called ________.

Biology
1 answer:
Zina [86]3 years ago
5 0

Answer:

Abduction

Explanation:

You might be interested in
What patterns do you observe on the second colorful map
VLD [36.1K]

Answer:the color explanes it's self old and young

Explanation:

4 0
2 years ago
What is most likely to occur if different plant species compete for the same
Nastasia [14]
I believe it would be A one will be eliminated
6 0
2 years ago
A. Measles generates a weak immune response that allows reinfection of hosts, and therefore does not easily evolve escape varian
Doss [256]

The correct answers are:

b. Human influenza a virus evolves escape variants, resulting in a distinctive cactus-shaped phylogeny.  

All types of Human influenza viruses evolve to escape immunity induced by prior infections and vaccinations.

c. Measles experiences strong selection for escape variants, resulting in a phylogeny similar to a nonpathogenic species.  

As a result of measles infection, specific antibody and CD4 and CD8 T cell responses are generated and contribute to virus clearance and protection from reinfection.

 


3 0
3 years ago
Choose all the answers and apply which of the following on ways to reduce wind erosion
wariber [46]
<h2>Answer:</h2>

The correct options are A,D and E which are plant trees, irrigate dry field and remove dead leaves respectively.

<h3>Explanation:</h3>
  • Wind erosion is the creation of big dust storm by small air rolls containing small particles like tillage and small dust particles.
  • Plant trees stops the formation of the small air rolls y providing physical resistance.
  • Remove dead leaves stops the tillage to contribute in dust storm.
  • Irrigate dry field decreases dust in air.
4 0
3 years ago
By which colors are biohazard symbols in the medical office identified
Marina CMI [18]

The color of biohazard symbols has identification in the medical office in which they identify which hazard is placed on the container such as;

<span>·         </span>Yellow bags – infectious waste, objects contacted with body fluids or human body parts

<span>·         </span>Red bags – syringes, IV bottles, tubings and catheters

<span>·         </span>Black bags – sharp materials and blades

<span>·         </span>Blue bags – glass, medicine and bottles

5 0
3 years ago
Read 2 more answers
Other questions:
  • Plants showing hydrotropism grow in response to _____.
    14·2 answers
  • What are 2 factors that regulate cell division
    6·2 answers
  • Which is not a function of a vacuole?
    8·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What are the systems of the body?
    11·2 answers
  • This food web reveals that, as matter flows
    7·1 answer
  • Explain how mining can be harmful to the environment
    10·1 answer
  • Carbon dioxide. We read about the excess of carbon dioxide in the atmosphere and now it may be influencing our climate. But the
    8·1 answer
  • What is neuroplasticity and why was its discovery significant
    6·2 answers
  • In this lab, you will simulate birds with three
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!