1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IgorC [24]
3 years ago
12

FLUS Full Time Grades 6-3

Biology
1 answer:
Serga [27]3 years ago
4 0

Answer:

A would be the correct answer I'm sure

Explanation:

Have a nice day

You might be interested in
Which of the following host defenses is considered the most effective in combating S. aureus infection?
LiRa [457]

Phagocytic response is considered the most effective host defenses in combating S. aureus infection.

<h3>What is phagocytic response?</h3>

Phagocytosis is a type of cell response that plays a key role in the course of an immune response as well as in the remodeling of tissues and the healing of wounds. Professional phagocytes are specialized cells that can carry out this task quite effectively.

<h3>What is S. aureus infection?</h3>

It has long been known that S. aureus is one of the most significant germs that harm humans. It is the main contributor to skin and soft tissue infections such cellulitis, furuncles, and abscesses (boils). Boils are the most typical staph infection form. This is a pus-filled pocket that forms in an oil gland or hair follicle. Typically, the skin around the infected area turns red and swells. To treat staph infections, doctors frequently administer cefazolin, nafcillin, oxacillin, vancomycin, daptomycin, and linezolid. Vancomycin may be necessary for staph infections that are severe. This is due to the fact that a large number of staph bacterium strains have developed resistance to other common antibiotics.

Thus from above conclusion we can say that phagocytic response is considered the most effective host defenses in combating S. aureus infection.

Learn more about the phagocytic response here:

brainly.com/question/28232491

#SPJ4

7 0
1 year ago
Some proteins do indeed need assistance during the folding process. the general term used for the proteins that help other prote
sergey [27]

Some proteins do indeed need assistance during the folding process. the general term used for the proteins that help other proteins fold is Chaperones.

<h3>What are Chaperones?</h3>
  • Chaperones are proteins that help big proteins or macromolecular protein complexes fold or unfold conformationally. There are different groups of molecular chaperones, all of which have the same purpose: to help big proteins fold properly during or after synthesis as well as following partial denaturation.
  • Protein translocation for proteolysis involves chaperones as well. The bulk of molecular chaperones aid in protein folding by binding to and stabilizing folding intermediates up until the polypeptide chain is entirely translated, rather than providing any steric information for protein folding.
  • Based on their target proteins and location, chaperones have different unique modes of operation.

Learn more about the Protein folding with the help of the given link:

brainly.com/question/28421475

#SPJ4

7 0
2 years ago
ANSWER NOW!!!!!!!!!!!! PLEASE :)
Temka [501]

Answer: 20 amino acids

Explanation: The 20 amino acids that are found within proteins convey a vast array of chemical versatility. The precise amino acid content, and the sequence of those amino acids, of a specific protein, is determined by the sequence of the bases in the gene that encodes that protein.

7 0
3 years ago
HELP PLEASE<br> Why do you think genetic diversity is an advantage of sexually reproduction?
Delvig [45]

Answer:

Genetic diversity is an advantage of sexual reproduction because it reduces the occurrence of unfavorable genetic traits and a variety of genes would lessen the chance of the extinction of a population due to environmental changes. The variation between a genetically diverse species will guarantee at least some of it survive when presented with different climates or challenges.

8 0
2 years ago
I’m having trouble, can someone help?
Vadim26 [7]
I think the answer is c because the cooler summers help cool down the earth preventing global warming
3 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which statement indicates what the fossil record suggests about evolution on Earth?
    12·1 answer
  • The simplest, yet most effective method of preventing the spread of an infectious disease is to:
    14·1 answer
  • Which statement best describes the process that occurs in the thylakoid
    14·1 answer
  • What is an example of a neuroendocrine gland?
    6·1 answer
  • An organism is heterozygous for a gene that follows Mendel's law of dominance. Which allele will be expressed as its phenotype?
    14·2 answers
  • When there is an excess of sodium in the body
    12·1 answer
  • What is another name for the large intestine? what digestive presses occurs in the large intestine?
    10·2 answers
  • When is the most likely time for a female to become pregnant during her menstrual cycle?
    13·1 answer
  • Enzymes ___________ the activation energy required for a chemical reaction which will ______ up the reaction process.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!