1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Westkost [7]
3 years ago
8

Use the passage to answer the following question. Athlete's Foot You don't have to be an athlete to get athlete's foot. But you'

re more prone to getting this infection if you hang around where athletes are- pools, locker-room showers, and changing rooms. Athlete's foot is caused by a fungus, and fungi like to grow in warm, dark, and humid places. The inside of a shoe, especially if your foot is wet from sweat, is heaven for fungi. The first sign of athlete's foot will probably be painful cracks between your toes. Over-the-counter foot sprays or powders may work, but if the problem persists, see a doctor who can prescribe anti-fungal drugs. To prevent the spread of the infection, dry your feet with a separate towel. The fungus that causes athlete's foot can persist for a long time. The best ways to prevent it are to keep your feet clean and dry, change your shoes and socks often, and use some sort of footwear in pools, locker-room showers, and changing rooms. Excerpted from"Your Fantastic Feet." Current Health 2, March 2004. © Weekly Reader Corporation What is the best way to treat fungal infections like athlete's foot? A. anti-fungal drugs B. antihistamines C. anti-viral drugs D. antibiotics
Biology
2 answers:
Ann [662]3 years ago
5 0

Answer:

Anti-fungal drugs

Explanation:

Korvikt [17]3 years ago
3 0
T<span>he best way to treat fungal infections like athlete's foot is anti-fungal drugs.</span>
You might be interested in
Why is death by predators more natural or right then death by starvation?
balu736 [363]
Predators have to eat. If things are good in an eco-system then the prey is eating good which means the predators can eat good also. Starvation means that things in the eco-system are going bad. Also, It helps the earth maintain its balance. If too much of any aspect of the system is removed it throws the whole thing off balance. too many herbivores will eat too much vegetation.
7 0
3 years ago
Which process produces human egg and sperm cells?
Ad libitum [116K]
Gametogenesis produces human egg and sperm cells
7 0
3 years ago
Read 2 more answers
When electrons are lost, a<br> When electrons are gained, a<br> ion is formed,<br> lon is formed
miskamm [114]

Answer: when one is lost, one is formed

6 0
2 years ago
Are microorganisms best suited for dry, warm environments?
gregori [183]

Answer:

The most significant effect of the microbes on earth is their ability to recycle the primary elements that make up all living systems, especially carbon, oxygen, and nitrogen (N). Primary production involves photosynthetic organisms which take up CO2 from the atmosphere and convert it to organic (cellular) material.

5 0
2 years ago
Which statement describes decomposers?
steposvetlana [31]

The statement “Decomposers are those organisms that recycle matter in the ecosystem” describes decomposers. Decomposers are organisms that break down dead or decaying organisms, and in doing so, they carry out the natural process of decomposition.

4 0
3 years ago
Other questions:
  • What 3 factors are needed for natrual selection to occur?
    10·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Ancient civilizations generally associated illness with ____.
    10·1 answer
  • Is this correct...? I need help..
    8·1 answer
  • The client with heart failure asks the nurse about the reason for taking enalapril maleate. the nurse should tell the client:
    8·1 answer
  • The lower esophageal sphincter surrounds the upper opening into the stomach. If this sphincter failed to properly constrict, it
    11·1 answer
  • What is the most significant contributor to sea level rise?
    14·1 answer
  • What is the probability of producing a child that will phenotypically resemble either one of the two parents in the following fo
    14·1 answer
  • What is one of the main concerns related to the increase of waste materials humans put
    7·1 answer
  • Type a summary of the phases of water and how a substance changes from one to the other.​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!