1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mashutka [201]
4 years ago
9

In the human body, which of the following is part of the axial skeleton?

Biology
1 answer:
evablogger [386]4 years ago
3 0
The correct answer is B.
You might be interested in
Which of the following processes causes the release of nitrogen back in to the atmosphere
Gekata [30.6K]
<span>It's Denitrification: In the absence of oxygen bactaria break down nitrates releasing nitrogen back into to the atmosphere and using the oxygen for their own respiration</span>
4 0
3 years ago
In one to two sentences, what are some ways to mitigate climate change?
Aloiza [94]

Answer:

Here are some of them

Explanation:

7 0
3 years ago
(i givs brainliest ovo + 50 points) Which of the following is an example of static electricity?
Ronch [10]

Answer:

B. Lights

Explanation:

One way to see this is that every other source is natural, while this is mainly caused manly.

3 0
3 years ago
Read 2 more answers
1. Molecules based on
JulijaS [17]

Answer:

Carbon is a major component of organisms. That's why they are also called carbon-based life forms.

8 0
4 years ago
Consider the following mRNA strand: CCAUGGCAAAGGAGUGACUAA
Nitella [24]

Answer:

If it helps, I only know the mRNA to DNA conversion:

GGT CCG TTT CCT CCT GTT

Explanation:

3 0
3 years ago
Other questions:
  • One reason tundra plants are small and grow close to the ground is that
    11·2 answers
  • The effect of alcohol on the human body is to __________
    6·1 answer
  • Which of the following describes how the skin of the integumentary system and the bones of the skeletal system work together in
    12·1 answer
  • Which of these best describes erosion?
    8·2 answers
  • Which parts of the water cycle require the water molecules to give away heat energy (cool<br> down)?
    11·2 answers
  • Biology! 10 points please help!
    11·1 answer
  • Question 4
    10·1 answer
  • What is the approximate speed of earth flying through space around the Sun?
    15·1 answer
  • The disruption of the cell cycle may lead to what
    9·2 answers
  • How many molecules of ATP is produced in glucosesis stage ?​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!