Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer: Lysosome
Explanation:
The lysosome is an organelle found in cells of eukaryotes.
Its functions include:
I) It contains several hydrolytic enzymes such as
- glycosidases that break down complex sugars (polysaccharides),
- proteases that break down proteins,
- and sulfatases that hydrolyze sulphur-containing compounds,
- other enzymes for lipids and Nucleic acids
II) it also digest worn out organelles, and engulfed viruses and bacteria.
III) and helps to remove wastes from the cell.
Enzymes are regulated by more than the binding of small molecules. A second method that is used all the time by eucaryotic cells to regulate a protein's function is the covalent addition of a phosphate group to one of its amino acid side chains. These phosphorylation events can affect the protein in two important ways.
The answer to the question is enzyme linked receptor.
The investment in education and training for people.