1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga nikolaevna [1]
3 years ago
12

Achondroplasia is a form of dwarfism inherited as a completely dominant trait. Two achondroplastic dwarfs have a dwarf child; la

ter, they have a second child who is normal. What are the genotypes of the two parents in this mating? What is the probability that their next child will be normal? A dwarf?
Biology
1 answer:
yulyashka [42]3 years ago
7 0

Answer:

There's 25% probability that their next child will be normal, and 75% of it being a dwarf.

Explanation:

Achondroplasia (A) is a dominant trait.

Two achondroplastic dwarfs (A_ x A_) have a dwarf child (A_) and a normal child (aa). The second child must be aa because if it had a dominant allele it would also be dwarf.

The only way for two achondroplastic parents to have a normal child is that <u>they are both heterozygous (Aa) for this gene.</u>

The cross Aa x Aa would produce the following offspring probabilities:

  • 1/4 AA - dwarf
  • 2/4 Aa - dwarf
  • 1/4 aa - normal

So there's 1/4=25% probability that their next child will be normal, and 3/4=75% of it being a dwarf.

You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
The ____ contains hydrolytic enzymes for the digestion of proteins, lipids, nucleic acids, and polysaccharides.
NeX [460]

Answer: Lysosome

Explanation:

The lysosome is an organelle found in cells of eukaryotes.

Its functions include:

I) It contains several hydrolytic enzymes such as

- glycosidases that break down complex sugars (polysaccharides),

- proteases that break down proteins,

- and sulfatases that hydrolyze sulphur-containing compounds,

- other enzymes for lipids and Nucleic acids

II) it also digest worn out organelles, and engulfed viruses and bacteria.

III) and helps to remove wastes from the cell.

4 0
3 years ago
How is it possible for two proteins in the same cell to perform different functions
DedPeter [7]

Enzymes are regulated by more than the binding of small molecules. A second method that is used all the time by eucaryotic cells to regulate a protein's function is the covalent addition of a phosphate group to one of its amino acid side chains. These phosphorylation events can affect the protein in two important ways.

8 0
3 years ago
When non nerve cells become invoved in response to signals whitch tipe of receptor gose into action
inna [77]

The answer to the question is enzyme linked receptor.

6 0
3 years ago
Which of the following is an example of human capital?
chubhunter [2.5K]

The investment in education and training for people.

6 0
3 years ago
Other questions:
  • Follicle stimulating hormone (FSH) is secreted by which gland?
    13·2 answers
  • Amoebic dysentery is caused by which of the following?
    5·2 answers
  • 3. What will likely happen to New York and Europe in the future?
    10·1 answer
  • Discuss the order in which seed dispersal mechanisms could have evolved
    11·2 answers
  • Transcribe the following DNA strand into a mRNA transcript:
    8·2 answers
  • Some scientists theorize that this behavior developed from the tactic of throwing smaller eggs to break them open. ostrich eggs,
    9·1 answer
  • All life depends on the availability of usable energy. This energy is released when
    12·1 answer
  • If you were testing a household cleaning product, what would be a reasonable pH for it and why would it have that pH value
    12·1 answer
  • A woman with normal vision is pregnant from a man with red-green colorblindness. Can they child produce a child that has red gre
    7·2 answers
  • In an ecosystem, which list of organisms is in the correct order from producer to top-level consumer? (20 points)
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!