1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ira [324]
3 years ago
14

How does specific heat influence biological systems?

Biology
2 answers:
Minchanka [31]3 years ago
7 0
Specific heat influences biological systems because it determines what the environment is. if it is cold they will have thick coats compared to one who are in the heat.
MA_775_DIABLO [31]3 years ago
3 0
A high specific heat enables organisms to resist temperature fluctuations.
You might be interested in
What molecules provides the energy to make glucose through photosynthesis?
Georgia [21]

Answer:

Sugar molecules. What molecules create sugar you ask 12 atoms of carbon, 22 atoms of hydrogen, and 11 atoms of oxygen

Explanation:

Plants convert energy from sunlight into sugar in a process called photosynthesis. Photosynthesis uses energy from light to convert water and carbon dioxide molecules into glucose (sugar molecule) and oxygen.

4 0
3 years ago
How would I do this
Masteriza [31]
This maps says world old geography condition.first stage of Earth continent
4 0
3 years ago
Were there many or few vessels serving as conduits between the lungs and the heart? why is this important?
EastWind [94]
True, there are many vessels serving as a conduit<span> between the lungs and the heart. 

The number of the vessel is many because all the carbon dioxide from body need to be released at the lungs. More vessel means more surface area and blood flow rate to do the diffusion of the gas which means increased diffusion rate. This will allow the lung to transfer oxygen and dump carbon dioxide faster.</span>
5 0
3 years ago
Are a group of cells working together to perform one or more specificc <br> functions.
Lana71 [14]

Answer:

That statement described a tissue.

5 0
3 years ago
Difference between mycoplasma and l form bacteria​
Snezhnost [94]

Answer:

L-form bacteria are distinct from mycoplasmas, because Mycoplasma spp. do not originate from bacteria that normally possess a cell wall. ... Some of these bacteria remain as CWDB (stable L-forms), whereas others revert back to possession of a cell wall (unstable L-forms).

Explanation:

5 0
3 years ago
Other questions:
  • At what point during primary succession does an ecosystem provide the fewest habitats for organisms?
    9·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • These are animals that share the common characteristics of body hair, production of milk, giving birth to live young, and endoth
    13·2 answers
  • 2. What is formed when elements of matter are chemically combined?
    6·1 answer
  • Where in the Cell is DNA found?<br> Mitochondria<br> Ribosome<br> Nucleus<br> Cytoplasm
    14·2 answers
  • Of the species below, only ________ is not an electrolyte.
    11·1 answer
  • In _________, a small sample of fetal cells is drawn by a needle inserted into the amniotic fluid surrounding the fetus. It prov
    6·2 answers
  • While Mikey was at the zoo, he classified the animals as he walked by their exhibits. Category 1 is for vertebrates, which are a
    10·2 answers
  • Enrique organized a campaign called Bulk It Up at his school. The campaign urged students to buy bulk products rather than singl
    12·1 answer
  • James Watt compared measurement of power produced by engines to
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!