1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sonbull [250]
3 years ago
13

The endosymbiotic theory states that chloroplasts and mitochondria evolved as a result of

Biology
2 answers:
Yuri [45]3 years ago
6 0
...As a result of a symbiosis between prokaryotic and eukaryotic cells. The theory is that the mitochondria and the chloroplasts were prokaryotic cells inside the eukaryotic cells which is called endosymbiosis. There is evidence for this because plastids and mitochondria have double membranes like prokaryotic cells and they also have their own genetic material.

Hope that helps and is in decent english as I studied it in spanish
makkiz [27]3 years ago
5 0

Answer:

a eukaryotic cell engulfing a bacterial cell.

Explanation:

You might be interested in
Describe the substrate specificity of chymotrypsin and the structural feature that determines this specificity.
serg [7]

Answer:

The main substrate of chymotrypsin includes tryptophan, tyrosine, phenylalanine and methionine

Explanation:

1.

Histidine yields a proton to aspartate and recovers it from serine.

Seen in another way: aspartate captures a proton from the serine through histidine.

2.

a) The serine (deprotonated) is thus capable of attacking the peptide bond (nucleophilic carbonyl attack) and forms a tetrahedral intermediate; The substrate is thus covalently bound to the enzyme (now it is a transition state).

b) The peptide bond is broken and the released amino terminus (R) recovers a proton from histidine.

c) Histidine, in turn, recovers it from aspartic.

3.

a) Aspartate captures a proton of histidine again, so that it can capture it in turn from water.

b) This generates a hydroxide anion that attacks the ester intermediate between the serine and the carboxyl part (R ′) of the substrate peptide.

c) A new tetrahedral intermediate bound to the enzyme is formed (via serine residue).

4.

a) The carboxyl group of the peptide is regenerated, the serine being separated and the other peptide fragment being free (the R ′ part with a free carboxyl end)

b) The serine recovers the proton at the expense of histidine, which in turn captures it from aspartic acid.

c) The catalytic triad (Asp, His, Ser) has been regenerated in its original state.

The net reaction is:

R–NH – CO –R ′ + H2O ⟶ R– NH2 + HOOC –R ′ ⟶ R – NH3 + + −OOC –R ′

The active site or catalytic center of chymotrypsin is formed by several amino acid residues, among which the essential role corresponds to the "catalytic triad".

5 0
3 years ago
PART II
Sidana [21]

Answer:

Iron -> Fe - Group 8

Silver -> Ag - Group 11

Mercury -> Hg - Group 12

Oxygen -> O - Group 16

Gold -> Au - Group 11

Potassium -> K - Group 1

Xenon -> Xe - Group 18

Magnesium -> Mg - Group 2

Hydrogen -> H - Group 1

4 0
3 years ago
After strenuous exercise sore muscles can occur because of?
Anna007 [38]

Answer:

The correct answer is C. A buildup of lactic acid in the tissues.

Sore muscles after vigorous exercise are the result of lactic acid accumulation in the muscles.

Vigorous exercise reduces the levels of oxygen available in the muscles due to which complete oxidation of the glucose could not take place.

Muscle cells switch to another process called as lactic acid fermentation to produce energy. In this process, lactate dehydrogenase converts pyruvate into lactate and reduces NADH to NAD⁺.

This NAD⁺ enables the continuation of glycolysis which results in the production of net 2 ATP.

In addition, influx of materials such as nutrients, WBC, anti-inflammatory compounds etc into the muscle cell (for repair) causes swelling of the muscle fibers which is also the reason for the muscle soreness.

8 0
3 years ago
Read 2 more answers
Enter the correct term in the blanks.
Amiraneli [1.4K]

Answer:

a. veins and arteries

b.diaphragm

c.kidney

d.lung

e.4

f.left auricle(atrium) , right auricle(atrium)

g.left ventricle, right ventricle

h.blood plasma

i.digestive

j.buccal cavity ,saliva

k.bile

l.excretory

m.kidneys

Explanation:

3 0
2 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • In which part of a flower is pollen produced
    5·2 answers
  • This simple bacteria cell has the same structure as more complex cells. It controls what comes in to and leaves the cell and als
    6·2 answers
  • What is the reason behind the high surface tension of water
    12·2 answers
  • Which factors contribute to changing igneous and sedimentary rock into metamorphic rock
    7·2 answers
  • When listening the levels of organization in organisms from smallest to most complex which level is just below organs complexity
    13·1 answer
  • How does doppler effect related to expanding universe
    7·2 answers
  • The footprints of a dinosaur and the burrow of an ancient shrimp are examples of which kind of fossils
    12·2 answers
  • Compare and contrast the similarities and differences between the senses of taste and smell.
    8·1 answer
  • 3) What is the smallest unit that can carry on all functions of life? please help ​
    8·1 answer
  • The arrangement of organs and tissues in their characteristic places in 3 - D space defines ______. A. pattern formation B. diff
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!