1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
scoray [572]
3 years ago
10

Which of the following best explains why buildings tip during earthquakes?

Biology
2 answers:
Vesnalui [34]3 years ago
6 0
<span>surface faulting moves the ground in different directions</span>
MariettaO [177]3 years ago
6 0

Answer:

d. surface faulting moves the ground in different directions

Explanation:

You might be interested in
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
What are two ways in which waves erode the land?
sashaice [31]

i believe the answer is Abrasion and Impact. Hope this helps :-)

7 0
3 years ago
The prefix mono- means “one” and the prefix poly- means “many”. How are these meanings related to the terms monomer and polymer
Dmitriy789 [7]

When a molecule is made up of one sugar unit, its called a monomer.

Eg. Glucose, galactose, fructose

When a molecule is made of more than one sugar units, its called a polymer.

Eg. Cellulose, glycogen

Polymers are usually macro molecules.

8 0
3 years ago
Which statement best explains why the force of a hurricane diminishes as the hurricane moves over land
Bad White [126]
The supply of warm, moist air decreases.
4 0
3 years ago
Read 2 more answers
Why is methane such a common molecule?
xxTIMURxx [149]

Answer:

Because it is formed by combining two elements i.e carbon and hydrogen.

6 0
2 years ago
Read 2 more answers
Other questions:
  • Three plants were tested under Red, Green and Yellow light. The growth of the plant was measured in centimeters.
    10·2 answers
  • Anemia is a blood disorder where there is a deficiency in the quantity of red blood cells and/or hemoglobin. Anemia can be inher
    9·2 answers
  • Based on the food chain below, if a bald eagle acquires 50 kg of energy, how much energy did the herbivorous duck get from the a
    6·1 answer
  • Why do you need a global perspective when planning for sustainable energy?
    5·1 answer
  • Microscopic fossils, or ______________, of single celled prokaryotic organisms that resemble modern bacteria have been found in
    9·1 answer
  • Horses and donkeys can interbreed, but their offspring (mules) are infertile. This is an example of what kind of reproductive is
    9·1 answer
  • If you want to improve your muscular endurance, what is the best plan?
    14·2 answers
  • What is a cell membrane and describe its structure and components.
    13·1 answer
  • Is dinosaurs dying considered a macroevoluation or a mikroevoluation?
    9·2 answers
  • If plant cells are grown on media containing radioactively labeled thymine for one generation, where will radioactively labeled
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!