1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xenn [34]
4 years ago
6

Bacteria are prokaryotic cells. By contrast, animal, plant, and fungal cells are eukaryotic What is the main difference between

prokaryotes and eukaryotes?
Biology
1 answer:
alexandr1967 [171]4 years ago
3 0

Answer:

I think the answer is that prokaryotes have a nucleus and eukaryotes do not.

Explanation:

It is the first thing I think of when I think of a difference between the two.

You might be interested in
Experimental data are collected as: x[100]={1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 2
solong [7]

hi myself thx for the points

8 0
3 years ago
Maria is growing strawberries in her back yard. She notices that the plants are producing baby plants from horizontal stems that
steposvetlana [31]

New clones plants (or baby strawberry plants) will develop at each nodes at varying intervals

3 0
3 years ago
Read 2 more answers
1.
Pani-rosa [81]
1. C. Hydrothermal Vents 
2. C. Trace amounts of resources 
3. Not Sure 
4. B. Conduct deep-sea research
5. D. New ocean floor (my best guess) (Not sure!) 

I hope this helps you! 

7 0
3 years ago
Read 2 more answers
Where is the energy in a polysaccharide stored?
kkurt [141]

Answer:

You store it: Glycogen

Explanation:

Excess glucose is stored in the liver as the large compound called glycogen. Glycogen is a polysaccharide of glucose, but its structure allows it to pack compactly, so more of it can be stored in cells for later use.

8 0
3 years ago
Read 2 more answers
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0
3 years ago
Other questions:
  • Explain why autonomous underwater explorers (AUEs) will provide entirely new kinds of information about ocean processes.
    14·2 answers
  • ANSWER QUICKLY
    12·1 answer
  • Which of the following is true about ice ages?
    12·2 answers
  • If 75% of our body is made out of water can we evaporate? Why or why not?
    10·2 answers
  • Hornworts have only one _______ in each of their cells.
    12·1 answer
  • This mammal retains its embryo in its uterus for a short time, then the embryo crawls out of the uterus and completes fetal deve
    11·1 answer
  • Do you believe you have a personal responsibility to protect the environment
    11·1 answer
  • Which is a component of cell theory?
    11·2 answers
  • Which photosystem releases the electrons for the electron transport chain?
    9·1 answer
  • Plz help me with this....
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!