1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bad White [126]
2 years ago
9

What would be the first thing you would do if you are burned by a chemical while performing a lab experiment?

Biology
2 answers:
White raven [17]2 years ago
8 0
You need to wash it off very well. Make sure you were proper safety gear before hand
vodka [1.7K]2 years ago
7 0
You would tell a teacher and probably contact medical personnel
You might be interested in
Which of the following is a true statement about codons?
kati45 [8]
Your answer would be A
3 0
3 years ago
Read 2 more answers
Only 3% of the water on earth is fresh water, the kind we need for drinking and growing food. Of that 3% , how much is locked in
spin [16.1K]

about...69%

or more than two-thirds

4 0
2 years ago
What is the definition of sodium potassium pump
Stells [14]

sodium-potassium pump. n. The enzyme-based mechanism that maintains correct cellular concentrations of sodium and potassium ions by removing excess ions from inside a cell and replacing them with ions from outside the cell.

6 0
3 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
There are three types of cells true or false
sveticcg [70]
<h2>False is the answer </h2>

Explanation:

hope it helps ^_^

6 0
2 years ago
Read 2 more answers
Other questions:
  • How do marine scientists use models to study the ocean?
    14·1 answer
  • The bacteria can chemically combine nitrogen with hydrogen to form ammonia (NH3). This combining process is called nitrogen fixa
    12·2 answers
  • Phenothiazines block neurotransmitter dopamine molecules from attaching to synaptic receptor sites. True or False
    6·2 answers
  • Is the length of shadows at noon higher in summer or winter?
    12·2 answers
  • Examine this food web for a particular terrestrial ecosystem which species is most likely a decomposer in this food web
    7·1 answer
  • in this phylogenetic tree, which two organisms on the tree would be expected to share the most characteristics
    6·1 answer
  • Is an aphid a producer
    5·1 answer
  • Harry notices that one of his houseplants does not grow very well compared to his other houseplants. He asks himself “What is di
    12·1 answer
  • which property has not been observed for membrane proteins being degraded for energy during biological pathways
    12·1 answer
  • What is the scientific term for rocks formed from lava?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!