1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
anzhelika [568]
3 years ago
8

What is eight out of eight as a fraction

Mathematics
1 answer:
Svetlanka [38]3 years ago
3 0

Answer: one whole


Step-by-step explanation:

8/8 = one whole

You might be interested in
David can paint a fence in ten hours. Alex can paint the same fence in eight hours. If
xxTIMURxx [149]

Answer:

40/9

Step-by-step explanation:

Use the work formula, \frac{1}{A} + \frac{1}{B} = \frac{1}{T}, where A is the amount of time it takes one person, B is the amount of time it takes another person, and T is the time it takes for them to work together.

Plug in the times for David and Alex alone:

\frac{1}{10} + \frac{1}{8} = \frac{1}{T}

Find the least common denominator, which is 40.

\frac{4}{40} + \frac{5}{40} = \frac{1}{T}

\frac{9}{40} = \frac{1}{T}

Cross multiply and solve for T:

9T = 40

T = 40/9

So, if they worked together, it would take them 40/9 hours

3 0
3 years ago
Read 2 more answers
What is the absolute value for 3.45?​
Lady bird [3.3K]

Answer:

∣∣3.45∣∣=3.45

Step-by-step explanation:

8 0
3 years ago
Read 2 more answers
Suppose 6 people chose oatmeal as their favorite breakfast food how would you change the bar graph
brilliants [131]
See how many others chose something else then graph it.
7 0
3 years ago
What is the equation in point-slope form of a line that passes through the points (3, −5) and (−8, 4) ?
maxonik [38]
ANSWER

y + 5= - \frac{9}{11} (x-3)

or

y - 4= - \frac{9}{11} (x + 8)

EXPLANATION

We want to find the equation in point-slope form of a line that passes through the points (3, −5) and (−8, 4).

The point-slope form is given by;

y-y_1=m(x-x_1)

where

m = \frac{4 - - 5}{ - 8 - 3} = \frac{4 + 5}{ - 11} = - \frac{9}{11}

is the slope of the line.

If

(x_1,y_1)=(3,-5)

The point-slope form is

y + 5= - \frac{9}{11} (x-3)

On the other hand, if
(x_1,y_1)=( - 8,4)

Then the point-slope form is,

y - 4= - \frac{9}{11} (x + 8)

These two equations are the same when simplified.
4 0
3 years ago
The answer to this problem
Brilliant_brown [7]
The answer would be 2.4
6 0
3 years ago
Read 2 more answers
Other questions:
  • -8+ 8b = 16 8b+8=16 -8=-8 8b=8
    10·1 answer
  • Compare the modeld for one third and two sixths
    5·1 answer
  • Suppose that a "code" consists of 4 digits, none of which is repeated. (A digit is one of the 10 numbers 0, 1, 2, 3, 4, 5, 6, 7,
    9·1 answer
  • The square of an integer number
    10·1 answer
  • A table is on sale for $481, which is 26% less than the regular price.
    8·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Karin observed that the water level in the part of the river she observed fell 1.68 millimeters per year for 1.5 years. Use the
    13·2 answers
  • Please someone help me: Complete the reasons for the proof.
    9·2 answers
  • Pls <br> helppp<br><br><br> thanks!!!
    5·1 answer
  • HELP, I’ll give the brainliest answer if correct
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!