How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGG
UUUUCAAGAA3 a. 7 b. 8 c. 9 d. 10 e. 16
1 answer:
Answer: 7
Explanation: During translation, several codons have special functions which they serve. AUG is called the initiation codon, it signals the beginning of polypeptide synthesis and also codes for methionine in the internal positions. UAA, UAG and UGA are called termination codons because they do not code for any known amino acid. They signal the end of a polypeptide synthesis.
Each codon is made up of three nucleotides. The number of codons between the initiation codon UAG and the termination codon UGA in the mRNA is seven, thereby encoding seven amino acids.
See the attached diagram for further illustration.
You might be interested in