How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGG
UUUUCAAGAA3 a. 7 b. 8 c. 9 d. 10 e. 16
1 answer:
Answer: 7
Explanation: During translation, several codons have special functions which they serve. AUG is called the initiation codon, it signals the beginning of polypeptide synthesis and also codes for methionine in the internal positions. UAA, UAG and UGA are called termination codons because they do not code for any known amino acid. They signal the end of a polypeptide synthesis.
Each codon is made up of three nucleotides. The number of codons between the initiation codon UAG and the termination codon UGA in the mRNA is seven, thereby encoding seven amino acids.
See the attached diagram for further illustration.
You might be interested in
Answer:
Option D, Zinc is higher on the activity series because there is clear evidence of a reaction.
Explanation:
It is very clear that a metal which is higher in activity will replace a metal having lower activity.
Since, Zinc has higher activity than copper, it is very sure that it in a copper chloride solution it will replace copper and produce zinc chloride solution leaving behind copper as residue.
Residues of copper is a clear evidence of reaction
The chemical equation for this reaction would be -
Hence, option D is correct