1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pogonyaev
3 years ago
12

What best defines photosynthesis​

Biology
2 answers:
Hitman42 [59]3 years ago
3 0

Explanation:

Photosynthesis is a process during which energy from light is harvested and used to drive synthesis of organic carbohydrates from carbon dioxide and water, generating oxygen. Photosynthesis is the only way that radiant energy from the sun can be converted into organic molecules for plants and animals to consume.

Lunna [17]3 years ago
3 0

Answer:

Photosynthesis is the process by which plants make their own foo in the presence of sunlight and chlorophyll

You might be interested in
The water cycle is also referred to as the _______ cycle.
Harman [31]
The water cycle is also referred to as the hydrologic cycle. 
6 0
4 years ago
What's the difference between nitrification and dentification
Y_Kistochka [10]

Difference between nitrification and dentrification

Explanation:

Nitrification and denitrification are part of the nitrogen cycle

Nitrification is the process of conversion of ammonium to nitrate by nitrifying bacteria like Nitrobacter and Nitrosomonas

Denitrification is the process of reduction of nitrate to nitrogen gas by denitrifying bacteria like Pseudomonos, Lactobacillus etc.

Nitrifying bacteria are autotrophs and grows slowly and need aerobic condition.  Denitrifying bacteria are hetertrophs and grows rapidly and need anaerobic conditions.

Nitrification requires a pH of about 6.5 to 8.0; denitrification takes place at 7.0 to 8.5

Nitrification provides soluble nitrates readily available in the soil to be easily absorbed by the roots.

Denitrification processes are used in wastewater or effluent treatment plants.

6 0
4 years ago
A biogenic sediment that forms from the accumulation of plant debris is known as _____.
Triss [41]
<span>A biogenic sediment that forms from the accumulation of plant debris is known as "Limestone"

Hope this helps!</span>
8 0
4 years ago
Rocks and Minerals as Resources Lab Activity
exis [7]

Mining is the birth of minerals and other geological accouterments of profitable value from deposits on the Earth.

  • Mining negatively affects the terrain by converting loss of biodiversity, soil corrosion, and impurity of face water, groundwater, and soil. Mining can also spark the conformation of holes. The leakage of chemicals from mining spots can also have mischievous goods on the health of the population living at or around the mining point.
  • In some countries, hidden-trapping companies are anticipated to cleave to recuperation and environmental canons to ensure that the area hidden-trapped is ultimately converted back into its original state. still, violations of similar rules are relatively common.

Loss Of Biodiversity

  • frequently, the worst goods of mining conditioning are observed after the mining process has desisted. The destruction or drastic revision of the pre-mined geography can have a disastrous impact on the biodiversity of that area. Mining leads to a massive niche loss for a diversity of foliage and fauna ranging from soil microorganisms to large mammals. Aboriginal species are most oppressively affected since indeed the fewest dislocations in their niche can affect extermination or put them at high threat of being wiped out. poisons released through mining can wipe out entire populations of sensitive species.

legislation related to mining-

  • There are different kinds of legislation. The legislation that needs land to be restored after mining tends to make mining to be veritably precious as it does so through the duty of some rules and regulations for the hidden-trapping companies.

  • Through this, it handles the responsibility of their land declination and takes back the land to its original form. This process is known to contribute to the fiscal counteraccusations of a company.

Why is it important to take land after mining?

Mining is known to be an act that disturbs the land. A lot of mines now are been known to reclaim the face in the course and after mining is completed, and therefore they return the land for useful purposes.

Reclaimed mine lands are known to be veritably beautiful and useful to wildlife and mortal uses.

Learn more about Mining here:

brainly.com/question/5168809

#SPJ10

3 0
2 years ago
Which nutrient is responsible for causing the most accidental deaths in children?
Stels [109]
The nutrient that is responsible for causing most accidental deaths in children is iron.
6 0
3 years ago
Other questions:
  • Which letter below would represent Adenine?*<br>А, В, or C​
    13·2 answers
  • How is cellular respiration related to photosynthesis <br> ​
    11·2 answers
  • In a particular breed of cattle, the trait of not having horns (Pp) is dominant over having horns (pp). The Punnett square below
    5·1 answer
  • Please I need help with questions 73 and 74 and 75 and it’s very hard and I’m struggling with it and if you need to see the pict
    14·2 answers
  • Which group of animal has the greatet known species diversity?
    10·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Be my friend!!!!!!!!!!!!!!! please?
    6·1 answer
  • Please select the word from the list that best fits the definition
    10·1 answer
  • Why do plants need to obtain carbon atom
    14·2 answers
  • List the structures in the circulatory system the blood travels through from the vena cava to aorta.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!