1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Solnce55 [7]
3 years ago
15

What is the effect of the biogeochemical cycles? cycling energy through a food chain recycling matter through the biosphere recy

cling rocks through the layers of Earth cycling nutrients through the human body
Biology
2 answers:
sveta [45]3 years ago
7 0

Answer:

Explanation:

On edg it’s B

jenyasd209 [6]3 years ago
4 0

Answer:

B

Explanation:

You might be interested in
Do dams purify water?
Marysya12 [62]

Answer:

I dont think so but i really dont know.

Explanation:

I dont know.

5 0
2 years ago
Read 2 more answers
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
A purebred purple flowering plant is crossed with a purebred white flowering plant, and they produce offspring that have purple
IgorLugansk [536]

The answer would be dominant
8 0
3 years ago
Read 2 more answers
Using very powerful microscopes, scientists estimate the volume of some of
pochemuha
C 9.0 103 cubic micrometer
6 0
2 years ago
Which months weather is most similar to April ​
loris [4]
March and January would be the most similar
6 0
2 years ago
Other questions:
  • "You are in your room listening to music and, realize you are thirsty, you can feel that your soda is no longer cold, and you de
    8·1 answer
  • calculate the potential energy of a rock with a mass of 55kg while sitting on a cliff that is 27 m high
    11·1 answer
  • What is ATP? List the three components of an ATP molecule. What is ATP used for?
    13·1 answer
  • Which of the following structures releases neurotransmitter molecules in a paravertebral ganglion?
    12·1 answer
  • Which is a better solvent of salt,
    9·1 answer
  • Regarding the geology of the oceans, creation scientists propose:
    8·1 answer
  • What kind of sensory adaption would you hypothesize the cave fish has to allow it to navigate in a cave, including catching and
    8·1 answer
  • PLEASE HELP
    10·1 answer
  • Which statement best describes how Watson and Crick's model used other scientists' work to create a model of DNA?
    14·2 answers
  • What term describes ocean water being forced onto land during a hurricane? white cap
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!