1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vladimir [108]
3 years ago
9

Viruses are parasites that use host cells to perform most of the functions of life. Which of the following is NOT provided by th

e host cell? Choose 1 answer: Choose 1 answer: (Choice A) A Genetic material for transcription (Choice B) B Ribosomes for protein synthesis (Choice C) C RNA polymerase (Choice D) D Proteins for cellular respiration
Biology
1 answer:
Setler79 [48]3 years ago
4 0
C is your answer here.
You might be interested in
Is the following true or false? A community must use its shared values to make decisions about scientific issues
True [87]
The sentence is true.

8 0
2 years ago
Read 2 more answers
If 32 packed volume units of cells are separated from 46 volume units of plasma from a blood sample, the haematocrit is _______
nordsb [41]

Answer:

If 32 packed volume units of cells are separated from 46 volume units of plasma from a blood sample, the hematocrit is <u>41,02%</u> percent. The hematocrit value is <u>within the normal</u> range.

Explanation:

Hello!

Hematocrit (or packed cell volume -PCV-)is defined as the percentage of red blood cells (vol%) in a blood sample. One common method of determining it is by centrifuging a heparinized blood sample in a capillary tube at 10 000 RPM for five minutes. This separates the blood sample in two layers, formed elements (RBC and WBC) and Plasma.

The length of the layers is directly measured from the tube and represents the volume of packed cells and plasma. Since the number of white cells is negligible compared to the number of red cells, the formed elements are considered to represent the red blood cells.

The hematocrit can be calculated as the volume of packed cells divided by the total volume of the blood sample.

\frac{PCV}{TOTAL(pcv+plasma} * 100

<u>In the question:</u>

\frac{32}{32+46} * 100 = \frac{32}{78} * 100 = 41,02%

In humans the normal hematocrit range is 40,7% to 50,3% for men and 36,1% to 44,3%. Taking these reference values into consideration, this sample is within the normal range.

I hope you have a SUPER day!

4 0
3 years ago
What are some bad things about ribosomes?
Orlov [11]
<span>Mutations in small ribosomal subunit biogenesis proteins that cause disease</span>
5 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
What do organelles help form in the next level of organization
taurus [48]
Organelles exist within cells, which exist within tissues. Communities exist within ecosystems, which exist in the biosphere.
3 0
2 years ago
Other questions:
  • What function is Responsible for controlling the development of the reproductive system
    10·1 answer
  • What is the probability of producing a tall pea plant from a generic cross between two hybrid tall pea plant
    12·1 answer
  • A father and mother that are both heterozygous dominant for tongue rolling mate. Tongue rolling is a dominant trait. answer any
    11·1 answer
  • Facts and opinions about the ocean ​
    7·1 answer
  • What surrounds (and is in contact with) muscles, gland, and other body cells, and gives rise to lymph fluid?
    7·1 answer
  • Which of the following is NOT an important characteristic of good mental and emotional health? A. independence B. sense of belon
    14·2 answers
  • HELP MEEE PLS
    14·2 answers
  • AMP-PNP is a non-hydrolyzable analog of ATP that can bind to proteins in a similar manner as ATP but is no longer hydrolyzed. Pr
    5·1 answer
  • A layer of sandstone is found on top of a layer of shale. what most likely happened in this area?
    7·1 answer
  • If cells from one part of an embryo are transplanted to another part, and they develop into the tissue they would have made orig
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!