1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnesinka [82]
3 years ago
10

Which of the following terms describes all of the non-living components of an ecosystem?

Biology
1 answer:
fiasKO [112]3 years ago
6 0

Answer:

abiotic

Explanation:

biotic is living abiotic is non living

You might be interested in
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Which of the following is true of enzymes?
dolphi86 [110]

Answer:

a

Explanation:

7 0
3 years ago
In Morocco, the first signs of dryness were seen after a major _______ 7 years before the video was made.
Musya8 [376]

Answer:

drought

Explanation:

8 0
3 years ago
What is the numerical expression for 1\2×(6×1+7)+11
solmaris [256]
I think that the numerical expresion for this problem is 17.5
8 0
3 years ago
In bone tissue, what substance is made by the cells?
Alona [7]
The answer to your question is B. matrix
7 0
3 years ago
Other questions:
  • Tsunami waves flood coastal and inland areas and affect coastal life. Which of these properties of tsunami waves most contribute
    12·1 answer
  • Dominic, a newborn, received antibodies from his mother through the placenta and breast milk. Which specific type of immunity is
    8·1 answer
  • What is the process that produces haploid (1n) cells is known as?
    6·2 answers
  • What is the difference between entomophily and anemophily?
    14·2 answers
  • in gel electrophoresis, DNA fragments move across a gel. describe what cause them to move in (2-3) sentences
    9·2 answers
  • Motor nerve and all the muscle fibers it controls is called
    14·1 answer
  • A patient who was in a car accident has lost their sense of smell. Which part of the brain is likely injured?
    6·2 answers
  • What is the relationship between a cheetah and a deer
    13·1 answer
  • 36. Mitosis requires the chromosome to be replicated into______ copies.<br> a. 2<br> b. 6<br> c. 1
    9·2 answers
  • Suzanne Simard and colleagues knew that the same mycorrhizal fungal species could colonize multiple types of trees. They wondere
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!