1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mamont248 [21]
3 years ago
6

What is the name of the principle that is based on greek and latin roots meaning "head-to-tail"?

Biology
1 answer:
telo118 [61]3 years ago
6 0
The principle is called CEPHALOCAUDAL PRINCIPLE.
This principle proposed that growth follow a particular pattern in which the head and the upper part of the body grow first before the growth proceeds to other part of the body. 
You might be interested in
Suppose you had a hypothesis you believed to be correct. What should you do to make it become a theory?
castortr0y [4]
You need to test the hypothesis several times and record all results. Once you obtain the same results several times, I think that means its a theory
8 0
3 years ago
Hydrogen ions have a positive charge why
Fantom [35]
Hydrogen has one valence electron. To make it an ion, you need to remove this valence electron. When you remove an electron, the element becomes positive because you are taking away the negative
4 0
3 years ago
True or false? Many environmentalists believe that reducing human population growth could improve environmental issues.
Lilit [14]
True! Earth is beginning to become very overcrowded and combined with the amount of people of the planet and the carelessness that they all have for it, the earth is slowly beginning to show it's age. Of course, no one will act on this opinion,  because it is quite illegal to just kill people, but it is true!
3 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
11. When did surfing begin (p.51)?
jarptica [38.1K]
I did this in my class a year ago and as far as i remember it was in the 1700 but i think 1767 to be exact
3 0
3 years ago
Other questions:
  • Please help!!!!!!!!!!!
    5·1 answer
  • What is an example of cytokinesis?
    14·2 answers
  • Trey is conducting an experiment to determine which fish food causes the most goldfish activity over a period of two weeks. He i
    6·1 answer
  • Which statement correctly compares seismic P-waves with seismic S-waves
    11·1 answer
  • How are the process by which animal and plants obtain energy different
    6·2 answers
  • Lysogeny is associated with all of the following except __________.
    11·1 answer
  • which membrane protein is responsible for restoring the original concentrations of sodium and potassium?
    9·1 answer
  • Why do animals have adaptations?
    10·1 answer
  • When glucose, a 6-carbon sugar, is broken down during glycolysis, what product forms?
    11·1 answer
  • a __ is a hollow ball of cells that results from mitosis from within an embryo. a) blastula b) blastopore c) protostome d) duete
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!