4 years ago

What helps the algae grow out of control?

Biology

1 answer:

Scorpion4ik [409]4 years ago

4 0

Answer:

Sunlight is a factor that allows algae to cover a large surface area in a small amount of time.

Explanation:

You might be interested in

Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ

Pani-rosa [81]

The probe would need to bind to the site
<span>TTTTAGCCATTTACGATTAATCG

The sites that are bold are were the probe need to bind in order to target the DNA. The sequence of the prob needs a site that is </span><span>complementary and antiparallel to it.</span>

4 0

4 years ago

What are waves that push forward and then go back are called

mrs_skeptik [129]

Answer:

riptide

Explanation:

7 0

3 years ago

Does a screw change the size of the effort force, the direction of the force, or both?

olganol [36]

It will not Hope that help

7 0

3 years ago

Read 2 more answers

A brown bird was crossed with a white one and all of the offspring were tan. Complete a Punnett Square analysis for this pair to

Alex73 [517]

Answer:

here.

Explanation:

The genes coding for colour show codominance. Both the brown and white pigment are equally expressed in the phenotype to give the tan colour.

Considering that the allele for brown pigment is CB and that for white pigment is CW, the genotype for the brown bird is CB CB and that for the white bird is CW CW.

Crossing CB CB × CW CW,

100% CB CW - tan-coloured birds

3 0

3 years ago

Which of the following would most likely be the effect of a mutation in DNA?

DochEvi [55]

Answer:

Explanation:

i take the test

3 0

3 years ago

Read 2 more answers