1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alekssr [168]
3 years ago
6

How do fish nets effect the ocean's ecosystem?

Biology
2 answers:
LenKa [72]3 years ago
8 0
Fish nets can be very detrimental towards the ecosystem, as they can trap unintended wildlife, which can horribly tilt the ecosystem one way or another.
zvonat [6]3 years ago
7 0
Yes, because they might not only catch fish , they might kill other Animals like turtles
You might be interested in
Which of the following is not a type of scientific model?
vagabundo [1.1K]

Answer:

The main types of scientific model are visual, mathematical, and computer models.

Explanation:

3 0
3 years ago
Why is it beneficial to use textiles made from synthetic fibers
mestny [16]
Synthetic fabrics<span> are </span>textiles made<span> from man-</span>made fibers<span> rather than natural </span>fibers. Chemically produced fabrics<span> are </span>made<span> by joining monomers into polymers, through a process called polymerization. A </span>synthetic fabric<span>, when magnified, looks like plastic spun together.</span><span>

Natural fabrics, such as cotton, silk, and wool, are made from animals or plant based fibers. While synthetic are man made and produced entirely from chemicals to create fabrics. such as polyester, rayon, acrylic, and more. The benefits of using textiles made from synthetic fibers is that it saves the animals and plants that the fibers are based off of. 

Hope this helped :)

</span>
5 0
3 years ago
The female portion of the flower is the
solmaris [256]
The answer to this question is b carpel that's the answer
4 0
2 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
All of these examples show evidence for evolution because they show<br> and
Natali5045456 [20]

Answer:

All of these examples show evidence for evolution because they show change over time and descent from a common ancestor

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which part of a phospholipid is hydrophilic
    14·2 answers
  • The indiscriminant use of antibiotics has produced resistant strains of __________. (points : 2)
    7·1 answer
  • What is the relationship among phylum,class and order?
    5·2 answers
  • What are the smallest building blocks of life?
    5·2 answers
  • List the quality control measures taken to ensure contamination does not occur during the Chelex extraction process (DNA extract
    15·1 answer
  • What is thymine and its purpose
    11·2 answers
  • Type of food . type of enzyme
    13·1 answer
  • Can you forecast an earthquake? Explain why or why not.
    8·1 answer
  • Someone please help me
    15·1 answer
  • it is often useful for scientists to study a population of cells that are all at the same stage of the cell cycle. for example,
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!