1.-Identify the different ways in which evolution can occur?

1 answer:

4 0

1. These four factors can effect ways evolution occur:

1.) Mutation
2.) selection
3.) Gene Flow
4.) Genetic Drift

2. In biology, a mutation is the permanent alteration of the nucleotide sequence of the genome of an organism, virus, or extrachromosomal DNA or other genetic elements.

Selection, in biology, the preferential survival and reproduction or preferential elimination of individuals with certain genotypes by means of natural or artificial controlling factors.

In population genetics, gene flow is the transfer of alleles or genes from one population to another.

Genetic drift is the change in the frequency of a gene variant in a population due to random sampling of organisms.

You might be interested in

For average organism, heavy digestion (overnight with an excess of enzyme) of chromatin with micrococcal nuclease would yield a

ASHA 777 [7]

Answer:

150 - 300 bp

Explanation:

Micrococcal nuclease, indistinctly from the time of treatment and in average organisms, will realize the cuts on DNA o RNA zones rich in AT or AU. It is not a specific endonuclease.

Even so, the mean size of the expected fragments will have between 150 bp and 300 bp.

It is very important to run your digestion along with a proper label.

5 0

3 years ago

Why does the mid-day winter sun not produce as much intense heat as the mid-day summer sun?

makkiz [27]

F. b and c only the Sun is closer to the horizon the Sun’s light is spread and diluted more

8 0

3 years ago

Mark as BRAINLIEST! !

Vikentia [17]

D looks like the oldest one because there is barley anything there. if not then I would do b

8 0

3 years ago

Read 2 more answers

I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran

Anarel [89]

Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.

4 0

3 years ago

Some bacteria live in the roots of plants like soybeans and peas.

PIT_PIT [208]

Answer:

Nitrogen is the most commonly limiting nutrient in plants. Legumes use nitrogen fixing bacteria, specifically symbiotic rhizobia bacteria, within their root nodules to counter the limitation. Rhizobia bacteria convert nitrogen gas (N2) to ammonia (NH3) in a process called nitrogen fixation.

5 0

3 years ago