1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iren [92.7K]
3 years ago
8

What is the hydrogen ion (H+) concentration of a solution of pH 8?

Chemistry
2 answers:
Harrizon [31]3 years ago
4 0

Answer:

\large \boxed{10^{-8}\text{ mol/L}}

Explanation:

pH = -log[H⁺]

\text{[H$^{+}$]}= 10^{-\text{pH}} \text{ mol/L} = \mathbf{10^{-8}}\textbf{ mol/L}\\\text{The hydrogen ion concentration is $\large \boxed{\mathbf{10^{-8}}\textbf{ mol/L}}$}

fgiga [73]3 years ago
3 0

Answer:

10−8 M.

Explanation:

In this problem we are given pH and asked to solve for the hydrogen ion concentration. Using the equation, pH = − log [H+] , we can solve for [H+] as,

− pH = log [H+] ,

[H+] = 10−pH,

by exponentiating both sides with base 10 to "undo" the common logarithm. The hydrogen ion concentration of blood with pH 7.4 is,

[H+] = 10−7.4 ≈ 0.0000040 = 4.0 × In this problem we are given pH and asked to solve for the hydrogen ion concentration. Using the equation, pH = − log [H+] , we can solve for [H+] as,

− pH = log [H+] ,

[H+] = 10−pH,

by exponentiating both sides with base 10 to "undo" the common logarithm. The hydrogen ion concentration of blood with pH 7.4 is,

[H+] = 10−7.4 ≈ 0.0000040 = 4.0 × 10−8 M.

You might be interested in
If 0.500L solution weighs 596g and contains 90.0g of oxalis acid, the concentration can be expressed as ?M, or ?(m/m)%, or ?(m/v
irinina [24]

Answer : The concentration can be expressed as, 1.99 M, or 15.1(m/m)%, or 18(m/v)%

Solution : Given,

Volume of solution = 0.5 L = 500 ml        (1 L = 1000 ml)

Mass of solution = 596 g

Mass of oxalic acid, (solute) = 90 g

Molar mass of oxalic acid = 90.03 g/mole

First we have to calculate the concentration in terms of M(molarity).

Molarity : Molarity is defined as the number of moles of solute present in one liter of solution.

Formula used : M=\frac{w_{solute}}{M_{solute}\times V_s}

where,

M = molarity of solution

w_{solute} = mass of solute(oxalic acid)

M_{solute} = molar mass of solute(oxalic acid)

V_s = volume of solution(in liters)

Now put all the given values in this formula, we get

M=\frac{90g}{90.03g/mole\times 0.5L}=1.99mole/L=1.99M

Now we have to calculate the concentration in terms of (m/m)%

(m/m)% : It is defined as the mass of solute present in mass of solution in grams.

Formula used : (m/m)\%=\frac{w_{solute}}{w_s}\times 100

where,

w_s = mass of solution

(m/m)\%=\frac{90g}{596g}\times 100=15.1%

Now we have to calculate the concentration in terms of (m/v)%

(m/v)% : It is defined as the mass of solute present in one milliliter of solution.

Formula used : (m/v)\%=\frac{w_{solute}}{V_s}\times 100

where,

w_s = mass of solution

(m/m)\%=\frac{90g}{500ml}\times 100=18%

8 0
3 years ago
How are volcanic mountains formed?
astra-53 [7]

Answer:

Volcanic mountains form as lava oozes forth from cracks in the earth. The lava builds up around the area where the eruption occurred. Layers build upon layers and over a period of time, a volcanic mountain forms. There are several ways that volcanic mountains are formed. Shield volcanoes, which are very wide with a gentle slope, are formed by long periods of eruption with low-viscosity lava.

Explanation: Hoped this helped! :)

5 0
3 years ago
Read 2 more answers
If a light ray strikes a flat mirror at an angle of 27 degrees, what will the reflected ray be?
Murljashka [212]

30 degrees from the mirror's surface

pretty sure It's correct and if it is then your welcome

8 0
3 years ago
Atomic hydrogen definition<br><br><br>​
natima [27]

Answer:

Hydrogen is the chemical element with the symbol H and atomic number 1. With a standard atomic weight of 1.008, hydrogen is the lightest element in the periodic table.

Explanation:

4 0
3 years ago
Read 2 more answers
AACGTACGATCGATGCACATGCATGGCTACGC
Pachacha [2.7K]

Explanation:

if u have biology A=T and G=C

id.k what ur question is supposed to mean..

7 0
3 years ago
Read 2 more answers
Other questions:
  • True or False: DNA is our genetic make-up. It is why we have a certain eye
    8·2 answers
  • The water is an example of a ________
    15·2 answers
  • Which phase groups the chromosomes of the daughter cells into new nuclei?
    7·1 answer
  • Which element has atoms with the strongest attraction for electrons in a chemical bond?
    6·1 answer
  • Describe and explain how electrical conductivity occurs in mercury bromide and mercury, in both solid and molten states.
    9·1 answer
  • Heat from the Earth's core and pressure on the remains of dead plants and animals create
    13·2 answers
  • You're a newly appointed Engineer in APE Chemical Sdn Bhd. and your first task is to design a 0.35m vessel to be used to store s
    13·1 answer
  • Making anyone branliest who answers correct and super fast
    14·1 answer
  • Is my answer correct?
    15·1 answer
  • Four liquids are described in the table below. Use the second column of the table to explain the order of their freezing points,
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!