1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Evgen [1.6K]
3 years ago
15

Where is the fluid that the lymphatic system collects returned to the blood?

Biology
1 answer:
My name is Ann [436]3 years ago
5 0

Answer:

The portal from the list very delicate vers nutrients tppppppp

Explanation:

You might be interested in
True or false scientists have found new organisms that have the ability to survive extreme temperatures great pressure depths or
DedPeter [7]
I think it is false because they still have the old ones
8 0
3 years ago
Read 2 more answers
What is the process of water moving down through the cell call
lidiya [134]

Answer:

Osmosis

Explanation:

Water moves across cell membranes by diffusion, in a process known as osmosis.

8 0
3 years ago
Which group of fish do scientists believe amphibians evolved from?
Alex73 [517]

Answer:Amphibians evolved during the middle of the Devonian period (416 to 359 million years ago) from the lobe-finned fish of the vertebrate class Sarcopterygii. Species within the genus Ichthyostega (members of the Labyrinthodontia subclass) are considered by some scientists to be the earliest amphibians.

Explanation:

4 0
3 years ago
Why is a cell analogous to an engineered watch? because it consists of numerous independent subunits because it consists of nume
skelet666 [1.2K]
A cell is analogous to an engineered watch because it consists of numerous interdependent sub units and also because coded information can not arise from random processes. A cell is the basic unit of living systems. Although it is relatively easy to visualize the components of cells, it is difficult to conceptualize how these components function together to sustain life within the cell. 
8 0
3 years ago
Read 2 more answers
Which of the following professions has NOT contributed significantly to the development of therapeutic use of herbs and pharmace
algol13
The correct answer is ANTHROPOLOGIST.
An anthropologist is a professional, who engaged in the study of various aspects of human within past and present societies. Such professionals are involved in the research and study of socio-historical, linguistic, and biological aspects of human. Biologist, chemist and botanist are actively involved in the development of drugs.<span />
4 0
3 years ago
Other questions:
  • What type of microscope is used to show the fine detail of cell organelles, as well as the spindle fibers and chromosomes as see
    15·2 answers
  • Judy poured herself a glass of ice water. After five minutes, Judy noticed water on the outside of the glass. What caused this w
    5·1 answer
  • If you run a marathon, your body will release _____ to elevate your mood and reduce your pain.
    7·1 answer
  • Many substances, such as cholesterol, bind to ________ on the cell membrane, triggering endocytosis?
    15·2 answers
  • What is the term for an organism's ability to survive and reproduce?
    5·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • The bulk of the atp for aerobic exercise comes from the oxygen-requiring process of _____.
    5·1 answer
  • What is a biotic factor?
    12·1 answer
  • The crustaceans in order Decapoda are important to the fishing industry because they may replace shrimp, lobsters, and crabs as
    14·1 answer
  • Original DNA coding strand: TAC CCG ACG GGC GAT AGT TTC
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!