1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kherson [118]
3 years ago
11

What might happen to a species if it has to compete for natural resources

Biology
1 answer:
MrMuchimi3 years ago
5 0
They might go extinct if they can't keep up with the competition
You might be interested in
Which of the following statements is true about the alpine biome, but not the taiga?
GuDViN [60]
Where are the statements
8 0
3 years ago
Read 2 more answers
Which of the following is not an example of income?<br> answer-food
Semmy [17]

Answer:

food

Explanation:

7 0
3 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
What was galilos contribution to the study of motion?​
In-s [12.5K]

Using the telescope, Galileo discovered the mountains on the moon, the spots on the sun, and four moons of Jupiter. His discoveries provided the evidence to support the theory that the earth and other planets revolved around the sun.

7 0
3 years ago
Do you know the Transcription factor name for lapF and naphthalene dioxygenase?
pickupchik [31]

Answer:

The LapF gene encodes one of the largest proteins from Pseudomonas putida, it is required for the bacterial colonization on the solid surfaces; while naphthalene dioxygenase is an enzyme required for the process of aerobic degradation of naphthalene.

Explanation:

LapF is a gene of Pseudomonas putida that is critical during the process of plant root colonization. Mutations in this gene have shown to reduce the ability to colonize plant tissues. On the other hand, the naphthalene dioxygenase gene is also encoded by the genome of Pseudomonas strains. The naphthalene dioxygenase protein catalyzes the hydroxylation of different substrates, however, this enzyme is widely known for acting during the degradation of naphthalene, an organic chemical compound that is toxic in humans.

4 0
3 years ago
Other questions:
  • HELLO PLEASE ANSWER MY QUESTION
    9·2 answers
  • Why are mitochondria bigger in animal cells
    12·1 answer
  • Scientific research shows that our global climate is changing. The global sea level is rising and ocean temperatures are increas
    6·2 answers
  • The continental United States is divided into two very large watersheds, one which drains into the _____ and the other into the
    12·1 answer
  • The order of impulse conduction in the heart, from beginning to end, is __________.
    6·1 answer
  • About how much time did it take for the ancestors of modern giraffes to evolve the long necks of modern giraffes?
    7·1 answer
  • What kinds of surface features are found on mercury? (select all that apply.)?
    15·1 answer
  • Which part of the DNA structure provides the genetic code for our traits?
    14·1 answer
  • What trait enables an organism to keep its internal body temperature constant?
    14·2 answers
  • 2. Why is it important to have diversity within a population?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!