All categories

3 years ago

Need help with this ! Thank you

Biology

2 answers:

Zanzabum3 years ago

6 0

Not sure to good to be true

KIM [24]3 years ago

3 0

Answer:

The first filial generation is Tt, Tt, tt, tt

Explanation:

The gene Tt seperate to yield two alleles "T" and "t"

The gene tt seperate to yield two alleles "t" and "t"

Then, each of the alleles goes into each space on the side and top. On crossing, the space would contain Tt, Tt, tt and tt

You might be interested in

X has successfully been transmitted to your body; you are now infected. All of the following among A-D are possible consequences

Natasha2012 [34]

The complete options to the question includes:

A.You never show any symptoms of disease and there is no sign of the pathogen in your body.

B.You exhibit mild symptoms of disease and the levels of the pathogen in your body are quickly reduced and eliminated.

C.You succumb to the worst effects of the disease but survive due to administration of antimicrobial agents.

D.You never show any symptoms of disease, but the pathogen persists in your body.

E.There are no exceptions, A-D are all plausible outcomes.

Answer: The correct option is A (You never show any symptoms of disease and there is no sign of the pathogen in your body).

Explanation:

Infectious diseases occurs when an individuals system is invaded by pathogenic microorganisms (virus,bacteria,fungi and parasite). These microorganisms may or may not cause disease but this depends on the healthy state of the host. They can also be transmitted from one person to another.

To explain the options why all are plausible outcomes when X has successfully been transmitted into the body except A includes:

B) option B can occur when the immune system of the host is able to combat X.

C.) Option C can occur when antimicrobial is given to suppress the activities of X

D) option D can occur when the individual may become an asymptomatic carrier of X. ( Individual shows no symptoms and signs of disease caused by X but the pathogen is still present in the body).

But option A is not possible as X must be present to show there was a transmission.

6 0

2 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

Which of the following would have resulted from the functions of prokaryotes on early earth?

Vitek1552 [10]

Not sure what the following is, but I think it could be less carbon in the soil

3 0

3 years ago

Read 2 more answers

What are the common promoter elements found in eukaryotic genes, and how are they different from enhancer elements?

V125BC [204]

Answer:

In eukaryotic cells you find core and proximal promoters.

Promotors are specific DNA sequences where transcription factors (proteins) and RNA polymerase binds to initiate transcription. Promotors are located upstream the coding sequence

Core promoters are where RNA polymersae binds and proximal promoters are where transcription factors bind.

Enhancer elements are DNA sequences where transcription factors (proteins) bind to increase the rate of expresion of an specific gene. Enhancers can be located either upstream, downstream or thousands of nucleotids away from the of the coding region.

Explanation:

Promoters and enhancer are key elements for controling gene regulation. Transcription begins when chromatin rearranges from a condensed state to a accesible state, this allow to transcrition factors and RNA polymerase to bind specif DNA sequences (promotors). Proteins bind to enhancers , this complex develops a DNA loop, so that the protein that is bound to the enhancer interacts with the RNA polymersase. When this interaction is made, the activity of the RNA polymerase is increased.

7 0

2 years ago

During which phase does a cell usually leave the cell cycle

vodka [1.7K]

Answer:

mitosis

Explanation:

7 0

3 years ago

Read 2 more answers