1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nika2105 [10]
3 years ago
5

What is carbon's bonding properties

Biology
1 answer:
Kisachek [45]3 years ago
3 0
The ability of carbon<span> atoms to form covalent bonds with other </span>carbon<span> atoms is the most unique of its </span>bonding properties<span>. This enables </span>carbon<span> to form long, continuous chains, branches and loops consisting of </span>carbon<span> and hydrogen in hydrocarbons and only </span>carbon<span> in </span>carbon<span> allotropes such as C60.</span>
You might be interested in
How does a dichotomous key help you identify unknown specimens based on their traits? Answer with details about the format and s
Aneli [31]
A dichotomous key helps you identify unknown specimens based on their traits because there are only two options available per trait. Selecting one from the two options (usually contrasting characteristics) from each step leads to smaller and smaller groups until the option is reduced to single and unique trait of an organism.

Considering you need to identify an organism. So, on the top of they key is animal with options: (a) with red blood cells and (b) no red blood cells. The option you will select is no red blood cells and under option b, you’re given two choices again: (a) hard bodies and (b) soft bodies. You’ll select soft bodies, then two options again are given: (a) with shell and (b) without shell. The option you’ll select would be without shell, and so on.
4 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
How does contour plowing in farming help to prevent pollution?
wel

D) Contour plowing is used to reduce erosion and sediment pollution.

Explanation:

Contour plowing in farming helps to prevent pollution by reducing surface erosion of topsoil and preventing sediment pollution.

Contour plowing is a farming technique in which crops are planted along the slopes of hills or contoured areas.

  • The rate at which rain water and precipitation moves along slope terrain is very fast.
  • This causes the washing off of the the topsoil on hills to eroded very fast.
  • Contour plowing breaks the slope and farming is done along movement on the contour.
  • This prevents topsoil erosion.
  • It also prevents sediment pollution in nearby streams and water bodies that are located around the valley at the base of the hill.

Learn more:

Soil erosion brainly.com/question/2473244

#learnwithBrainly

8 0
3 years ago
Which type<br> Of lava would most likely form lava tube caves: a'a or pahoehoe
MA_775_DIABLO [31]
It's from the Hawaiian language and means the words "shiny, glassy surface, and smooth". The type of lava you want to know is Pahoehoe lava. Lava tubes are usually floored with it.

Hope this helps! :-)
3 0
4 years ago
Describe how the colors you see would change if you were to dive from the surface to down deep in the ocean. What would things l
Luden [163]

Answer:

Answer is below.

Explanation:

First of all, it would be much darker the deeper you go. On the surface, the light from the sun touches the ocean, making the ocean look like a light blue. However, if you dive down even deeper, you will find a darker blue, and later nothing (the sun won't touch the deep parts of the ocean, so all you would see is darkness). The short answer to this is: It's lighter around the surface, and darker the deeper you dive down into the ocean.

hope this helps

Brainly is appreciated :)

5 0
4 years ago
Other questions:
  • Short pea plants exist in the P1 and F2 generations. What happens to the phenotype in the F1 generation?
    14·2 answers
  • Mass wasting occurs when____.
    6·2 answers
  • What would be the difference between a gene mutation and a chromosomal mutation?
    11·1 answer
  • How dose competition affect a population
    6·1 answer
  • A nuclear envelope does not usually form around each set of chromosomes in the haploid daughter cells in _________. A. interphas
    9·1 answer
  • In mammals, bulk flow only refers to the movement of oxygen (either into or out of the lungs and within the bloodstream). Bulk f
    7·1 answer
  • Describe the structural differences between plant and animal cells.
    7·2 answers
  • What would happen if complexes I-IV of the electron transport chain pumped protons in the opposite direction?
    15·1 answer
  • What period has the least amount of biodiversity
    6·1 answer
  • What impact does nitrogen depletion have on the ecosystem?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!