Carbondioxide, being a green house gas has the property of trapping the heat from the sunlight and thus increasing the temperature of the place. As more and more rain forests are cut down and burned, there is an increase in this green house gas in the atmosphere thus leading to a steady increase in the temperatures.
As we look at the graphs that are given, we can see that the graph C shows the steady increase in the temperature as the time passes. Hence option C is the right answer
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
B) they work independently of one other
Maybe a concussion or fractured vertebrae. Please mark Brainliest!!!
The southerly lowlands of the island average around 0 °C<span> (</span>32 °F) in winter, while the Highlands of Iceland tend to average around −10 °C<span> (14 °F). The lowest temperatures in the northern part of the island range from around −25 to −30 °C (−13 to −22 °F). The lowest temperature on record is −39.7 °C (−</span>39.5 °F<span>).</span>
