Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
Carbon dioxide and oxygen are recycled through photosynthesis and cellular
respiration forever unless something interrupts.
Explanation:
Photosynthesis and cellular respiration are two distinct and opposite metabolical processes undergone by living cells. They are opposite processes because one utilizes the products of the other as reactants.
Photosynthesis is a unique process to autotrophic organisms like plants. It is the process whereby plants synthesize their food in form of organic molecules (glucose) by combining Carbondioxide (CO2) and water (H2O) in the presence of sunlight.
The overall equation of photosynthesis is as follows:
6CO2 + 6H2O ------> C6H12O6+ 6O2
On the other hand, cellular respiration is the process whereby living cells obtain energy (ATP) by breaking down food molecules (glucose) using oxygen to produce carbondioxide (CO2) and water as products. The overall equation is:
C6H12O6 + 602 -----> 6CO2 + 6H2O
Based on the lab experiments, it can be concluded that Carbon dioxide and oxygen are recycled through photosynthesis and cellular
respiration because photosynthesis recycles/reuses the products of cellular respiration, which are C02 and H2O while cellular respiration recycles/reuses the products of photosynthesis, which are C6H12O6 and O2. This process occurs naturally in the environment and will continue to do so unless something interupts.
Option B is incorrect because light energy from the sun powers photosynthesis while option C is incorrect because photosynthesis transforms light energy to chemical energy while cellular respiration transforms chemical energy to thermal energy.
Answer:
I think its land is heated through radiant energy
Answer:
The bottom of the cleft is in the palm domain. It is lined with beta sheet.
Explanation:
During DNA synthesis, a single DNA strand is being built in by polymerization of nucleotides. These polymerization process is catalyzed by enzymes called DNA polymerase. These DNA polymerase can be visualized as an open right hand which is composed of a thumb domain, a finger domain and a palm domain. The palm domain contains a prominent beta-sheet that forms a plate at the button of the DNA-binding cleft.
Answer:
The correct answer is - Observations generate a scientific question, leading to a hypothesis, which can be tested through an experiment.
Explanation:
In any scientific knowledge development process, scientists need to follow the scientific process in a particular sequence that helps in developing and testing a hypothesis.
The sequence has:
observation: Observation requires you to pay attention to occurrences around
Forming question: on the basis of observation form a question about why that occurrence happens.
Hypothesis formation: The hypothesis is your initial prediction on why that happens.
Experiment: The experiment is being done in order to collect data and analysis so you can test your hypothesis