1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VikaD [51]
3 years ago
9

Viruses, although not considered to be alive, attack host cells and cause disease. The attack of a host cell is necessary for th

e virus to survive for all of the reasons listed EXCEPT one. That is
A) they cannot synthesize proteins because they lack ribosomes and must use the ribosomes of their host cells to translate viral messenger RNA into new proteins.
B) they cannot produce or store energy in the form of ATP and have to get their energy from the host cell.
C) they parasitize the host cell for basic molecules like amino acids, nucleotides, and lipids.
D) they lack DNA so they must use the DNA of the host cell
Biology
2 answers:
abruzzese [7]3 years ago
7 0
<span>D) they lack DNA so they must use the DNA of the host cell

Viruses do in fact have their own DNA.</span>
lakkis [162]3 years ago
7 0

Answer:

D) they lack DNA so they must use the DNA of the host cell

Explanation:

All but they lack DNA/RNA so they must use the DNA of the host cell. Viruses do contain DNA or RNA, which they inject into the host cells. Viral RNA is used to produce viral proteins from the organelles and molecules in the host cell.

You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
What conclusions can we draw from the lab about photosynthesis and cellular
GuDViN [60]

Answer:

Carbon dioxide and oxygen are recycled through photosynthesis and cellular

respiration forever unless something interrupts.

Explanation:

Photosynthesis and cellular respiration are two distinct and opposite metabolical processes undergone by living cells. They are opposite processes because one utilizes the products of the other as reactants.

Photosynthesis is a unique process to autotrophic organisms like plants. It is the process whereby plants synthesize their food in form of organic molecules (glucose) by combining Carbondioxide (CO2) and water (H2O) in the presence of sunlight.

The overall equation of photosynthesis is as follows:

6CO2 + 6H2O ------> C6H12O6+ 6O2

On the other hand, cellular respiration is the process whereby living cells obtain energy (ATP) by breaking down food molecules (glucose) using oxygen to produce carbondioxide (CO2) and water as products. The overall equation is:

C6H12O6 + 602 -----> 6CO2 + 6H2O

Based on the lab experiments, it can be concluded that Carbon dioxide and oxygen are recycled through photosynthesis and cellular

respiration because photosynthesis recycles/reuses the products of cellular respiration, which are C02 and H2O while cellular respiration recycles/reuses the products of photosynthesis, which are C6H12O6 and O2. This process occurs naturally in the environment and will continue to do so unless something interupts.

Option B is incorrect because light energy from the sun powers photosynthesis while option C is incorrect because photosynthesis transforms light energy to chemical energy while cellular respiration transforms chemical energy to thermal energy.

7 0
3 years ago
40 POINTS!! ANSWER CORRECTLY FOR BRANLIEST!
lapo4ka [179]

Answer:

I think its land is heated through radiant energy

7 0
3 years ago
Read 2 more answers
In which domain is the bottom of the DNA-binding cleft? What type of secondary structure lines the bottom of the cleft? In which
Archy [21]

Answer:

The bottom of the cleft is in the palm domain. It is lined with beta sheet.

Explanation:

During DNA synthesis, a single DNA strand is being built in by polymerization of nucleotides. These polymerization process is catalyzed by enzymes called DNA polymerase. These DNA polymerase can be visualized as an open right hand which is composed of a thumb domain, a finger domain and a palm domain. The palm domain contains a prominent beta-sheet that forms a plate at the button of the DNA-binding cleft.

8 0
3 years ago
Which sequence furthers scientific knowledge? Hypotheses generate a scientific question, leading to observations, which can be t
Greeley [361]

Answer:

The correct answer is - Observations generate a scientific question, leading to a hypothesis, which can be tested through an experiment.

Explanation:

In any scientific knowledge development process, scientists need to follow the scientific process in a particular sequence that helps in developing and testing a hypothesis.

The sequence has:

observation: Observation requires you to pay attention to occurrences around

Forming question: on the basis of observation form a question about why that occurrence happens.

Hypothesis formation: The hypothesis is your initial prediction on why that happens.

Experiment: The experiment is being done in order to collect data and analysis so you can test your hypothesis

9 0
3 years ago
Read 2 more answers
Other questions:
  • As part of an experiment on circadian rhythms, a laboratory rat’s brain has been lesioned. The animal is now falling asleep and
    10·1 answer
  • Which planets are classified as terrestrial ??
    12·2 answers
  • What is a slow, continuous process while what is sudden and less frequent.
    9·2 answers
  • An example of natural selection is the tail of a male peacock. The females of the species choose mates based on the colors of th
    5·1 answer
  • Sparky and Bailey are bacteria that represent two extremes of antibiotic sensitivity. Sparky cannot survive any exposure to peni
    12·1 answer
  • The cells lining the proximal convoluted tubule have numerous microvilli and mitochondria. these structures are critical for the
    10·2 answers
  • Which ocean zone would be most damaged by the construction of a new resort?
    10·2 answers
  • What name is given to the process that restores the diploid number of chromosomes?
    12·1 answer
  • What effect does increased carbon dioxide
    13·1 answer
  • Two pure substances combine to make a new substance. The new substance cannot be
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!