Answer:
1
Explanation:
4 HBr + O2 → 2H 20 + 2Br 2
...............
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Photosynthesis is the process where plants create energy. It requires water, carbon dioxide and sunlight. The end result is glucose, which the plants consume, and oxygen. Cellular respiration requires oxygen and glucose. The end result is carbon dioxide, ATP, and water.
Answer:
The light emitted by a light bulb is a form of radiation that occurs when the filament heats up and its thermal emission gains enough energy to move into the visible spectrum.
Explanation:
Light bulbs contain a filament which is heated up electrically. When this filament is heated up,energy in the form of heat is imparted to the electrons in the filament.
This thermal excitation of electrons ultimately leads to emission of light in the viable spectrum. This light is now radiated through a light bulb.
33 - 15 = 18
This element is P-33