1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Scrat [10]
3 years ago
11

In your biology lab, The distinguishing animal trait "A," that separates the body forms of the eumetazoa and then parazoa use a

stereoscopic microscope to observe a living animal that uses only one opening to both take in its food and eject its waste products. What is the body arrangement of this animal
Biology
1 answer:
nikklg [1K]3 years ago
3 0

Answer:

The options:

A. incomplete digestive tract

B. gastrovascular cavity

C. complete digestive tract

D. complete digestive tract and a gastrovascular cavity

E. incomplete digestive tract and a gastrovascular cavity

The CORRECT ANSWER IS E.

E. incomplete digestive tract and a gastrovascular cavity

Explanation:

Phylum Cnidaria; Cnidarians are diploblastic with two embryonic germ layers -the ectoderm and the endoderm) with well structured tissue, performs extracellular digestion, and use cnidocytes for defence and to catch prey.

Cnidarians have two unique morphological body plans which are referred to as polyp, its sessile in adults, and medusa are mobile; some species has both body structures in their lifecycle.

It undergo extracellular digestion, where enzymes dissolve the food substances as its cells lining the gastrovascular cavity take in the nutrients.

Cnidarians are known to have a body arrangement of incomplete digestive system with just one opening; the gastrovascular cavity that functions as both a mouth and an anus.

The cnidarians undergo extracellular digestion, the food is moved to the gastrovascular cavity, enzymes are present in the cavity, with the cells lining the cavity taken in nutrients. The gastrovascular cavity possess a singular opening that acts as a mouth and an anus; this is referred to as an incomplete digestive system.

You might be interested in
Which of the following is NOT one of the
Dimas [21]

The way that does not successfully classify protists is their size. Thus, the correct option is C.

<h3>What are Protists?</h3>

Protists may be defined as one of the diverse taxonomic groups and particularly a kingdom of eukaryotic organisms that are unicellular and sometimes colonial or less often multicellular and that generally include the protozoans, most algae, and often some fungi.

On the basis of the way that Protists reproduce, they can be subdivided into three types: Sexually reproducing protists, asexually reproducing protists, and conjugation-based.

On the basis of how protists get energy and food, they are again subdivided into three categories.

  • Animal-like protists: Heterotrophs that have the ability to move.
  • Plant-like protists: Autotrophs that have the ability of photosynthesis.
  • Fungi-like protists: Heterotrophs have cells with cell walls.

On the basis of the way that they move, they are subdivided into two types: Motile protists and non-motile protists. They generally move with the help of cilia, flagella, and pseudopodia.

Therefore, the size is not one of the following ways that protists are grouped. Thus, the correct option for this question is C.

To learn more about Protists, refer to the link:

brainly.com/question/2169979

#SPJ1

8 0
1 year ago
To help sort out those bacteria that have the vgp gene, scientists first attempt to grow the bacteria both in a medium with ampi
kotegsom [21]
Bacteria without plasmid will only grow in the media without penicillin since it doesn't have immunity.
Bacteria with recombinant plasmid with VGP gene, n<span>on-recombiant plasmid, Recombinant plasmid but no vgp gene can grow in both media(with or without penicillin) because they can withstand penicillin.</span>
8 0
3 years ago
give two examples of each of the following. annual crops, biennial crops, perennial crops, cereal crops, oil crops, vegetable cr
Natali5045456 [20]

Answer:

Annual crops : wheat, rice

Biennial crops : Banana, plantain

Perennial crops : Potato, onion

Cereal crops : Sorghum, Millets

Oil crops : Sunflower, Mustard

Vegetable crops : Asparagus, tomato

Explanation:

7 0
3 years ago
Emest Rutherford's atomic model included a nucleus comprised of positive particles called protons. Later, James Chadwick discove
Anit [1.1K]

Answer:

D

Explanation:

It can't be A as nuclei must be positive.

It can't be B as nuclei must contain at least one proton, and no electrons.

Technically C may be true, but the question is asking about the nucleus. Not the electron cloud. Electrons aren't found in the nucleus. Only protons and neutrons.

7 0
3 years ago
An important piece of information for meteorologists is the ratio of the amount of water vapor in the air to the amount of water
aleksandrvk [35]

Answer:

Explanation:

doppler radar, radiosondes, weather satellites, buoys and other instruments are fed into computerized NWS numerical forecast models. The models use equations, along with new and past weather data, to provide forecast guidance to our meteorologists

6 0
3 years ago
Other questions:
  • A molecule containing two atoms of hydrogen and one atom of oxygen in combination is called
    5·2 answers
  • Lichens, represented by this symbiotic relationship, are responsible for _____________ or the establishment of a new site for pl
    7·1 answer
  • What elements do all four macromolecules have in common
    10·1 answer
  • Which type of selection leads to increased phenotypic and genetic variation?
    12·2 answers
  • Environmental pollution does not affect an individuals lah
    12·1 answer
  • How is matter converted into light?
    12·1 answer
  • Thermohaline circulation is strongly influenced by the _____ of seawater.
    12·2 answers
  • AUUUAACUGUUCUGUCUAGAG
    6·1 answer
  • Which natural polymers are involved with making clothing?
    5·1 answer
  • HELP PLeaze
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!