1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olchik [2.2K]
3 years ago
11

Which statement best describes how global winds influence climate?

Biology
2 answers:
astraxan [27]3 years ago
5 0
I think the correct answer from the choices listed above is option B. Global winds affect or influence climate moving warm air towards the poles. Global winds<span> are caused by pressure differences in the atmosphere from warm air rising to the poles. Hope this answers the question.</span>
scoray [572]3 years ago
4 0
 The correct option from the choices listed above is an option :
B. Global winds affect or influence climate moving warm air towards the poles. Global winds are caused by pressure differences in the atmosphere from warm air rising to the poles.
Explanation:
Global wind belts and calm regions have an effect on,<span> </span>is that the<span> berg winds blow from the east and die out as </span>they available close to<span> the equator. The westerlies blow from the west and move storms across the </span>u. s.<span> The easterlies blow from the east </span>and that they<span> cause stormy weather to occur </span>once<span> cold air forms this belt meets </span>heat<span> air of the westerlies.</span>


You might be interested in
For one month Siera calculated her home town’s average high temperature in degrees Fahrenheit. She wants to convert that tempera
Soloha48 [4]
This representates the temperature of F degrees Fahrenheit converted to degrees Celsius. Remember that in order to change temperature we need to use the following formula:  <span>from Fahrenheit to Celsius: first subtract 32, then multiply by 100/180</span>
4 0
3 years ago
Read 2 more answers
PLS HELP WILL GIVE BRAINLIEST (everything is in the pic)
Whitepunk [10]

Answer:

The answer is Sedimentary Rock

Explanation:

When magma roucks are combined with stable rocks, the mixtire creates a sedimentary rock form.

4 0
3 years ago
Read 2 more answers
What is other word for carefully looking at an object or process beginning with the letter O and is 8 letters long
asambeis [7]
The word is observing
6 0
3 years ago
The peripheral nervous system connects the ____ sense to the ____ because it is connected to the spinal cord . Please help!!!
Mars2501 [29]
I’m not entirely sure but I think it’s eyes to the brain
5 0
4 years ago
Please help ASAP!!!
Harlamova29_29 [7]
I’m not sure. Im pretty sure it’s D.
6 0
3 years ago
Read 2 more answers
Other questions:
  • What are animals ribs made from
    9·2 answers
  • What do you think would happen to the gull population if there were only 10 nest sites ?
    7·1 answer
  • What is Charles Darwin's major contribution to science? A. He categorized thousands of species to compare their different traits
    14·2 answers
  • A balance between gravity pulling atoms toward the center and gas pressure pushing heat and light away from the center is called
    13·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • I’ll give brainliest.<br><br> What is the climate comparison between New Hampshire and Arizona?
    5·1 answer
  • Hurryyyy plzzz im timed!!!!!!!!!!!!!!!!!
    6·1 answer
  • 4. If seismographs showed a specific region as earthquake prone, what proposed solutions
    5·1 answer
  • What is the correct choice<br><br><br> bio<br> —————————————
    11·2 answers
  • Why do scientists think current warming trends are not simply Earth's natural
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!