1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marishachu [46]
3 years ago
6

Asexual reproduction produces

Biology
2 answers:
Law Incorporation [45]3 years ago
8 0
Asexual reproduction creates offspring that is exactly identical to the parents. they are essentially clones
Verizon [17]3 years ago
5 0
Asexual reproduction has one parent and are genetically identical as the parent
You might be interested in
Explain why the growing of willow for biofuel is an example of sustainable development.
Anuta_ua [19.1K]
Growing willow for biofuel is sustainable development because it is a source of fuel which potentially will never run out. For every willow tree that is cut down, another can be planted in its place. This means that the source of fuel is potentially limitless and subsequently sustainable.
5 0
3 years ago
if the united states continues using petroleum in vast amounts, it will become even more dependent on foreign sources for this r
Snowcat [4.5K]

Since we've been using petroleum in vast amounts organizations such as OPEC have appeared which restricts the U.S which ensued our country into suing; if this lawsuit passes then we will possibly be taking more petroleum than ever before due to it's demand such as it's needed for machinery and vehicles and etc. Most petroleum are from middle eastern countries, so our dependency will run rampant which will make us adhere to any of their policies pertaining to this fossil fuel in the near future.

8 0
3 years ago
Triangle XY Z is similar to triangle PQR.<br><br><br> Solve for n.
Naya [18.7K]
Answer:
XY/PQ=YZ/QR=XZ/PR
35/28=YZ/12=30/n
35/28=30/n
5/4=30/n
5n=120
n=120/5
n=24
4 0
3 years ago
Read 2 more answers
The benefit of measuring the initial rate of a reaction, V0, is that early in the course of the reaction, A) Km is the substrate
aleksandr82 [10.1K]

Answer:

Rate of product formation is linear and [S] has not been lowered significantly.

Explanation:

The rate of enzyme-catalyzed reactions is affected by several factors, the contraction of substrates [S] is one of them. The substrate concentration keeps on changing as the reaction proceeds. This is why the reaction rate is measured at the initial stages of reactions when the substrate concentration [S] is much greater than the concentration of the enzyme. It is called the initial rate or initial velocity.

Under the conditions of higher substrate concentration and relatively much lower enzyme concentrations, only a few molecules of substrates are being converted into product. At a relatively higher substrate concentration, the rate of product formation increases linearly.

4 0
3 years ago
PLEASE HELP!!! WILL GIVE BRAIN!!!!
Molodets [167]

Answer:

the grass grew taller and the hawk population declined

Explanation:

have a good day

5 0
3 years ago
Other questions:
  • Your family owns a bakery and has kept the same "family recipe" for bread for over 50
    5·1 answer
  • Which of the following factors contributes to reemergence of disease more than the appearance of a new disease?
    6·2 answers
  • Give two examples of fermentation in real life.
    6·1 answer
  • David and his lab partner are dissecting an earthworm during biology lab. They are cutting the earthworm with a scalpel in order
    8·2 answers
  • Nuclear envelope forms at each pole, spindle dissolves, chromosome uncoil occur during?
    15·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • A student knows the width and
    6·2 answers
  • Someone plss help me {no links please} i barely have any points so please only answer if you know
    8·2 answers
  • If the dna sequence is TAC CCC AAG CTC GGT ATC. what is mRNA<br><br> tRNA<br><br> AA?
    6·1 answer
  • Why is the making of metamorphic rock a chemical change? Explain your answer no using 9009le​
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!