1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kodGreya [7K]
3 years ago
13

An organism has the genotype "Aa" for a particular trait. As a result of segregation during meiosis, what alleles will each game

te contain? two copies of "a" one "A" and one "a" two copies of "A" one "A" or one "a"
Biology
1 answer:
schepotkina [342]3 years ago
8 0

when an organism has Aa genotype for a particular trait, during segregation each gamete should contains one A and one a allele for proper segregation.

You might be interested in
In order to decrease the genetic diversity of a population, you would need to
Basile [38]
Remove individuals from a population
6 0
3 years ago
Which of these statements are accurate? Hexokinase is a type of transferase that catalyzes the transfer of a phosphoryl group fr
Agata [3.3K]

Answer:

A. The conformational shift that occurs when glucose, but not water, enters the active site prevents water from hydrolyzing ATP. True

B. Hexokinase consists of two domains, or lobes, that come together when glucose and the MgATP2–MgATP2– complex are bound. True  

C. Hexokinase is a type of transferase that catalyzes the transfer of a phosphoryl group from ATP to a hexose. True

Explanation:

A. Hexokinase suffers and conformational changes by binding glucose in a reaction that prevents ATP hydrolysis.

B. Hexokinase is an enzyme with two domains that function by binding to the substrate (i.e., glucose). The region linking both protein domains is responsible for the catalytic activity.

C. Hexokinase is a type of transferase that catalyzes the transfer of a phosphoryl group from ATP to a hexose. During the first stage of glycolysis, the hexokinase transfers one phosphorous group from magnesium-ATP (Mg-ATP) to one hexose molecule, such as fructose, mannose or glucose.

 

False statements:

- Most kinases require the presence of a monovalent metal ion cofactor to prevent ATP hydrolysis. False: In canonical kinases, conserved amino acids bind to divalent metal ions before the transference of the phosphate group to their substrates.

- Hexokinase is found in the mitochondrial membrane. False: Hexokinase is found in the cytosol.

- Hexokinase transfers the terminal phosphate of ATP to carbon 3 of glucose. False: Hexokinase catalyzes the transfer of the terminal phosphate ATP to form glucose 6-phosphate.

5 0
3 years ago
Where did the energy to power the light-independent reactions come from?
trapecia [35]

Answer:

oh dum the answer is A

Explanation:

6 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
What is the animal kingdom classification chart?
nordsb [41]
Kingdom, phylum, class, order, family, genus, and species is the classification chart levels in order from most broad to least.
3 0
3 years ago
Other questions:
  • Alison wants to construct the perpendicular bisector of mn¯¯¯¯¯¯¯. what should alison do for her first step?
    9·2 answers
  • What does it mean to say that a gene is expressed? what does it mean to say that a gene is expressed? information in dna is used
    8·1 answer
  • How does acid rain affect aquatic animals?
    12·1 answer
  • Why does the velocity of blood slow greatly as blood flows from arterioles into capillaries?
    14·1 answer
  • What period did ice-age mammals first appear?
    8·1 answer
  • In order to survive organisms must have the ability to ?
    10·1 answer
  • If you stir salt into boiling water, your produce a
    11·1 answer
  • In which of the following tissues would one expect to see a lot of tight junctions?
    10·1 answer
  • Geneticist have determined that the majority of individuals in an isolate island population have blood type b. type a blood is f
    10·2 answers
  • Genes determine the of organisms. why do you guys give a whole essay for a dang answers but thx anyways
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!