1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
allochka39001 [22]
3 years ago
15

When sediment, containing soil and rocks, is eroded, it is usually deposited somewhere else, by wind, ice, water and even gravit

y. In this model, water has weathered the existing sediment and rocks. Where in this model has deposition taken place? A) F B) B C) C, F D) B, C
Biology
2 answers:
xz_007 [3.2K]3 years ago
3 0

Answer:

Deposition is the geological process in which sediments, soil and rocks are added to a land form or land mass. Wind, ice, water, and gravity transport previously weathered surface material, which, at the loss of enough kinetic energy in the fluid, is deposited, building up layers of sediment.

Explanation:

alina1380 [7]3 years ago
3 0
Deposition took place in part c
You might be interested in
Which of the following will NOT cause mass extinction?
ArbitrLikvidat [17]

Answer:

D. None of the above

Explanation:

<u>Reason that Drastic Change in weather may cause mass extinction</u>

Weather plays an important role in the survivability & the growth/diminish of the population. For example, animals that need large amounts/bodies of water (for example fishes), will not survive when the area is hit with a heat wave & drought, which would cause fishes to surface, and die.

<u>Reason that Geological change would play a large role in mass extinctions</u>

While the Geography is constantly changing, large abrupt changes would cause a upheaval and may upset the population, leading to a depletion of resources or even a sudden destruction of part/all of the population. For example, an earthquake may kill large amounts of animals, and the destruction of the greenery in the area may severely limit the amount of food/decrease the primary consumer's populations, leading to a starvation.

~

8 0
3 years ago
Read 2 more answers
The evolution of membrane-bound organelles in eukaryotic cells resulted in many benefits to the cell. Describe three membrane-bo
Rzqust [24]

The mitochondrion is a membrane-bound organelle that provides energy by ATP synthesis (oxidative phosphorylation)

The lysosome contains about 40 hydrolytic enzymes that help with cellular digestion.

The Golgi apparatus plays an important role in the excretion and packaging of vesicles.

8 0
3 years ago
What happens to the number of particles in the sample
Verdich [7]
These question makes no sense

sorry xx
3 0
3 years ago
Which is the role of the electron transport chain in the process of photosynthesis? A. Cycling electrons between photosystem and
Elina [12.6K]

Answer:

c.

Explanation:

Because youcaring electrons from photosystem II, to photosystem I, to NADP+

I took this test about it hope that helps :D

5 0
4 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Other questions:
  • List the 4 levels of organization in the human body from smallest to largest.give an example of each level.
    8·1 answer
  • If two parents display distinct forms of a trait and all of their offspring (of which there are hundreds) display the same new f
    13·1 answer
  • Which type of organism developed first?
    7·1 answer
  • Proteins are involved in what type of cellular activities?
    5·1 answer
  • Complete the sentence below by selecting the correct words from the drop-down menus. Factors that affect natural selection inclu
    10·1 answer
  • What type of mutation is shown in the sequence below
    11·1 answer
  • GIVING BRAINLIEST!!!!!!
    13·1 answer
  • What bacteria live in the root nodules of legumes?
    13·1 answer
  • Short paragraph to encourage people not to engage in rhino poaching ​
    9·2 answers
  • What are some characteristics of animals in “class”
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!